a programming pathway for electronic order entry
Báo cáo khoa học: "A Programming Language for Mechanical Translation" doc
... only symbols Both format S and format A are designed for the particular characters available on the printers and card punches in current use Other formats may be made available if and when other ... separated by a space, the left half and the right half are separated by an equal sign, the right half and the routing are separated by two fraction bars, and the routing and the go-to are separated ... of an abbreviation in the routing calling for format A, a special transliteration takes place The purpose of this transliteration is to allow all of the characters available on the input and...
- 17
- 214
- 0
Báo cáo khoa học: Fatty acid omega-oxidation as a rescue pathway for fatty acid oxidation disorders in humans pot
... SLC2 5A2 CPT2 ACADVL ACADM ACADS HADHA HADHB HADHA HADHB HADHSC ACAA2 ETFDH ETFA ETFB DECR1 CPT 1A CACT CPT2 VLCAD MCAD SCAD LCHAD LCKAT LCHAD LCKAT SCHAD MCKAT ETFDH ETFa ETFb DECR1 11q13 3p21 ... carnitine palmitoyltransferase I, mitochondrial carnitine acylcarnitine translocase and carnitine palmitoyltransferase II [5–7] In case of the straight-chain and 2-methyl-branched chain FAs, b-oxidation ... phenotype, dominated by retinitis pigmentosa, culminating in blindness with anosmia, cerebellar ataxia and a range of other more variable abnormalities The only therapy available to date is a life-long...
- 13
- 475
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... of amplified message DNA ladder is marked M (A) HaCaT keratinocytes (lane 1); normal epidermal keratinocytes (lane 2); C1–4 squamous cell carcinoma (lane 3); dermal fibroblasts (lane 4); epidermal ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...
- 11
- 475
- 0
the mit press processing a programming handbook for visual designers and artists sep 2007
... make programming tedious and can make programs difficult to read Instead of using multiple variable names, we can use arrays An array can store a list of data elements as a single name A for structure ... personal desire for escape or transformation Leon Hong created an elegant flying simulation in which the player floats above a body of water and moves toward a distant island Muskan Srivastava wrote ... software examples Each student maintains a web page containing all of their software and source code created for the class These pages provide a straightforward way to review performance and make...
- 735
- 7,160
- 0
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... JAMA 1999, 282:267-270 British Medical Association and the Royal Pharmaceutical Society of Great Britain: British National Formulary March edition London; 2003 National Coordinating Council for ... involved in critically revising the draft JG made substantial contributions to the data analysis GB was substantially involved in the analysis, interpretation and drafting the manuscript Acknowledgements ... physician order entry systems in facilitating medication errors [see comment] JAMA 2005, 293:1197-1203 Kane SL, Weber RJ, Dasta JF: The impact of critical care pharmacists on enhancing patient...
- 6
- 526
- 0
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
... retrieved information out of the medical and nursing file and the laboratory data Renal function was noted for every patient and renal failure was defined as calculated creatinine clearance less than ... study KC was responsible for conceiving the study, data acquisition, analysis of the data, statistical analysis and drafting of the manuscript BC was responsible for data acquisition, analysis of ... prescriptions at screening day APACHE II is the acute physiology and chronic health evaluation score at day SOFA is the sepsis-related organ failure assessment score at screening day Renal failure is creatinine...
- 9
- 738
- 1
A dynamic programming algorithm for RNA structure
... calculate the gap matrices For a given gap matrix, we have to consider all the different ways that its diagram can be assembled using one or two matrices at a time (Again, Feynman diagrams are ... bifurcation diagram in wx (left) with an additional diagram (right) to take into account such a coaxial stacking con®guration The coaxial scoring function depends on both base-pairs (Coaxial diagrams ... bases can also appear inside multiloop diagrams Notice also that the coaxial diagram in equation (11) really corresponds with four new diagrams because once we allow pairing, dangling bases also...
- 16
- 688
- 0
Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx
... MAPKa and ATF2D115 (A) 10% SDS ⁄ PAGE analysis showing activated, p38 MAPKa (lane 1) and its MS analysis (Mr 41 731 Da observed; 41 726 Da calculated) (B) 12% SDS ⁄ PAGE showing ATF2D115 (lane ... overexpressed, activated and purified In our case a sensitive tryptic analysis indicates that the enzyme was fully activated [27] v Vmax ¼ AB aKA KB þ aKB A þ aKA B þ AB ð1Þ The rapid equilibrium assumption ... obtained from Sigma NiSO4 and Ni-NTA agarose for His6-p38 MAPKa purification were provided by Qiagen Inc (Santa Clarita, CA, USA) and Sigma, respectively The His6 tag was removed from p38 MAPKa...
- 15
- 554
- 0
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
... from the American Type Culture Collection (Manassas, VA, USA) and maintained in our laboratory, was also used For cell culture, RPMI-1640 (Dainippon Pharmaceutical Co Ltd, Osaka, Japan) supplemented ... H2SO4 and the absorbance was measured at 450 nm Quantification of each cytokine (in ngÆmL)1 for IFN-c and in pgÆmL)1 for IL-12p70) was performed based on the standard curve in each assay Preparation ... downstream 47 base pairs, designated NF-jBd (5¢-CAT GGG GAC TCT CCC TTT GGG AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 consensus sequence oligonucleotide (5¢-GGA AGC...
- 10
- 395
- 0
A Resource List for Adolescent Reproductive Health Programming in Conflict Settings pot
... Regional Clearing House on Population Education and Communication, Asia and Pacific Regional Bureau for Education, with UNFPA; Bangkok, Thailand, 2003, PDF, 74 pages “Setting Standards for Youth Participation: ... examples (Costa Rica, Malaysia, Mexico, Philippines, South Africa, Tanzania, Thailand and Tunisia) of ongoing adolescent health and development programs to illustrate how these programs are learning ... examples (Costa Rica, Malaysia, Mexico, Philippines, South Africa, Tanzania, Thailand and Tunisia) of ongoing adolescent health and development programs to illustrate how these programs are learning...
- 16
- 314
- 0
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx
... Val334, and Val336 on M4 and Ala726 and Asp730 on M6 Alanine-scanning mutagenesis along segment M4 of yeast H+-ATPase showed that replacement of Ile331 and Val334 had little or no effect on ATP-dependent ... aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids adjacent to ... (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol...
- 13
- 514
- 0
báo cáo hóa học: " Intention as an indicator for subjective need: A new pathway in need assessment" doc
... manuscript LZ participated at the design of the study and at the data acquisition followed by data preparation for the current analysis RP participated at data acquisition and data preparation for the ... The authors are grateful to Alexander Craig for reading the manuscript Author Details 1Department of Mental Health and Cognitive Capacity, Federal Institute for Occupational Safety and Health, ... these considerations that precede health behaviour and actual usage of health care Social and health psychology have a long tradition of dealing with these kinds of motivational factors and their...
- 10
- 367
- 0
báo cáo hóa học:" Research Article Existence and Multiplicity of Positive Solutions of a Boundary-Value Problem for Sixth-Order ODE with Three Parameters" pdf
... symbol of the linear differential Au Bu Cu operator Lu u At the same time, in investigating such spatial patterns, some other high -order parabolic differential equations appear, such as the extended ... 2.1 Let A b2 − 3ac, B bc − 9ad, C c2 − 3bd, Δ B2 − 4AC, 2.2 one has the following: Equation 2.1 has a triple root if A B 0, Equation 2.1 has a real root and two mutually conjugate imaginary roots ... fourth -order boundary value problems with two parameters,” Journal of Mathematical Analysis and Applications, vol 281, no 2, pp 477–484, 2003 S Fan, “The new root formula and criterion of cubic equation,”...
- 13
- 397
- 0
báo cáo hóa học:" Research Article Multiple Positive Solutions of a Singular Emden-Fowler Type Problem for Second-Order Impulsive Differential Systems" pdf
... } Then AT , ≤ is bounded Define A { λ, μ ∈ R2 \ { 0, } | 3.20 has a positive solution at λ, μ } Then A / ∅ by Lemma 3.4 and A, ≤ is a partially ordered set Lemma 3.6 Assume D1 ∼ D6 Then A, ≤ is ... solution at 0, s for all < s ≤ μ∗ Thus { 0, s | s > 0} ∩ A is a nonempty chain in A and by Lemma 3.7, it has unique supremum of the form 0, s∗ in A This implies that 3.20 has a positive solution at ... Corollary 5.1 is valid for problem 5.4 satisfy 5.5 22 Boundary Value Problems Acknowledgment This work was supported for two years by Pusan National University Research Grant References S C Hu and...
- 22
- 259
- 0
báo cáo hóa học:" A shifted Legendre spectral method for fractional-order multi-point boundary value problems" ppt
... fractional differential equations Appl Math Lett 24, 2146–2152 (2011) 20 Saadatmandi, A, Dehghan, M: A new operational matrix for solving fractional -order differential equations Comput Math Appl ... problems for fractional differential equations with constant and variable coefficients Moreover, Rehman and Khan [27] derived a Legendre wavelet operational matrix of fractional order integration and applied ... (2000) Khan, Y, Faraz, N, Yildirim, A, Wu, Q: Fractional variational iteration method for fractional initial-boundary value problems arising in the application of nonlinear science Comput Math Appl...
- 35
- 310
- 0
báo cáo hóa học:" Existence of positive solutions for fourth-order semipositone multi-point boundary value problems with a sign-changing nonlinear term" docx
... problem at resonance Nonlinear Anal 24(10), 1483–1489 (1995) [5] Gupta, CP, Ntouyas, SK, Tsamatos, P: On an m-point boundary value problem for second -order ordinary differential equations Nonlinear Anal ... [7] Gupta, CP: Solvability of a three-point nonlinear boundary value problems for a second order ordinary differential equation J Math Anal Appl 168, 540–551 (1992) 23 [8] Gupta, CP: A sharp condition ... Nonlinear Anal 23, 1427–1436 (1994) [6] Gupta, CP, Ntouyas, SK, Tsamatos, P: Solvability of an m-point boundary value problem for second order ordinary differential equations J Math Anal Appl 189,...
- 25
- 221
- 0
Báo cáo hóa học: " Research Article Liouville Theorems for a Class of Linear Second-Order Operators with Nonnegative Characteristic Form" potx
... and applications to PDE’s,” to appear in Proceedings of the American Mathematical Society Alessia Elisabetta Kogoj: Dipartimento di Matematica, Universit` di Bologna, a Piazza di Porta San Donato ... Bologna, Italy Email address: kogoj@dm.unibo.it Ermanno Lanconelli: Dipartimento di Matematica, Universit` di Bologna, a Piazza di Porta San Donato 5, 40126 Bologna, Italy Email address: lanconel@dm.unibo.it ... theorems for a class of hypoelliptic ultraparabolic equations,” in Geometric Analysis of PDE and Several Complex Variables, vol 368 of Contemporary Math., pp 305–312, American Mathematical Society,...
- 16
- 238
- 0
Báo cáo hóa học: "A CLASSIFICATION SCHEME FOR NONOSCILLATORY SOLUTIONS OF A HIGHER ORDER NEUTRAL DIFFERENCE EQUATION" ppt
... Zhang, and W.-T Li, On a higher order neutral difference equation, Mathematical Analysis and Applications (Th M Rassias, ed.), Hadronic Press, Florida, 2000, pp 37–64 [5] X Z He, Oscillatory and ... a higher order neutral nonlinear difference equation, Journal of the Australian Mathematical Society Series A 67 (1999), no 1, 122–142 [8] X Tang and J Yan, Oscillation and nonoscillation of an ... and asymptotic behaviour of second order nonlinear difference equations, Journal of Mathematical Analysis and Applications 175 (1993), no 2, 482–498 [6] B S Lalli, Oscillation theorems for neutral...
- 19
- 290
- 0
Báo cáo hóa học: "MAXIMUM PRINCIPLES FOR A CLASS OF NONLINEAR SECOND-ORDER ELLIPTIC BOUNDARY VALUE PROBLEMS IN DIVERGENCE FORM CRISTIAN ENACHE " pptx
... Philippin, Some maximum principles for nonlinear elliptic equations in divergence form with applications to capillary surfaces and to surfaces of constant mean curvature, Nonlinear Analysis (1979), ... Applications, World Scientific, New Jersey, 2006 [2] C Enache and G A Philippin, Some maximum principles for a class of elliptic boundary value problems, to appear in Mathematical Inequalities & Applications ... See, for instance, Ladyˇ enskaja and Ural’ceva [5] for an account on this topic Consequently, we z will tacitly assume the existence of classical solutions of the problems considered in this paper...
- 13
- 332
- 0
Báo cáo hóa học: " Research Article Liouville Theorems for a Class of Linear Second-Order Operators with Nonnegative " docx
... and applications to PDE’s,” to appear in Proceedings of the American Mathematical Society Alessia Elisabetta Kogoj: Dipartimento di Matematica, Universit` di Bologna, a Piazza di Porta San Donato ... Bologna, Italy Email address: kogoj@dm.unibo.it Ermanno Lanconelli: Dipartimento di Matematica, Universit` di Bologna, a Piazza di Porta San Donato 5, 40126 Bologna, Italy Email address: lanconel@dm.unibo.it ... theorems for a class of hypoelliptic ultraparabolic equations,” in Geometric Analysis of PDE and Several Complex Variables, vol 368 of Contemporary Math., pp 305–312, American Mathematical Society,...
- 16
- 246
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008