a potential case for the wto dispute settlement mechanism

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... catalytic domains; black dots, protease cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... semipermeabilize cells for intracellular staining, cells were incubated in 4% paraformaldehyde for 30 at °C in the first instance and then stained as described above Confocal microscopy and imaging...

Ngày tải lên: 19/02/2014, 05:20

14 670 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢), the apparent molecular mass of which was remarkably ... Maruyama S, Takahara M, Miyagishima SY, Mori T, Nishida K, Yagisawa F, Nishida K, Yoshida Y et al (2004) Genome sequence of the ultrasmall unicellular red alga Cyanidioschyzon merolae 10D Nature ... cyanobacteria [22] and that C paradoxa first branched during the evolutionary process of chloroplasts [23] Shibata et al [21] isolated the thylakoid membranes and PSII particles from C paradoxa and reported...

Ngày tải lên: 23/03/2014, 15:21

11 503 0
Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

... C 3a and C 5a levels bypassing the traditional complement activation cascade There are few reports on complement activation in anorexia nervosa available in the peer-reviewed literature, dating back ... of the complement cascade and analyzed the activities of the alternative complement activation pathways [24] Serum levels of C3, Factor B and D, hemolytic activity of the alternative pathway, and ... limit the power of our statistical analysis and make our data vulnerable to a statistical type II error Therefore, our data not allow for advocating complement serum levels as a new biomarker...

Ngày tải lên: 09/08/2014, 01:21

6 441 0
Civil liability resulting from transfrontier environmental damage: a case for the Hague Conference? pot

Civil liability resulting from transfrontier environmental damage: a case for the Hague Conference? pot

... liable for the damage under the applicable national law In addition, the principle of joint and several liability was adopted for damage caused in the course of operations for the loading and unloading ... information on the content and application of the different laws The law of the place of the damage (lex damni) The law of the place of the damage (lex damni) can also be protective of the plaintiff’s ... character of the activity causing damage, which is not the case in German law.105 In addition, while in German law the holder may be held liable, at least partially, for damage caused by normal...

Ngày tải lên: 23/03/2014, 00:20

87 284 0
Báo cáo hóa học: " Uniqueness of the potential function for the vectorial Sturm-Liouville equation on a finite interval" doc

Báo cáo hóa học: " Uniqueness of the potential function for the vectorial Sturm-Liouville equation on a finite interval" doc

... h and H = H □ Footnote This work was partially supported by the National Science Council, Taiwan, ROC Author details Department of Mathematics, Tamkang University, No.151, Yingzhuan Rd., Danshui ... China Authors’ contributions Both authors contributed to each part of this work equally and read and approved the final version of the manuscript Competing interests The authors declare that they ... The readers may think that if all Q, h and H are diagonals then Lm(Q, h, H) is an uncoupled system Hence, everything for the operator Lm(Q, h, H) can be obtained by applying inverse spectral theory...

Ngày tải lên: 20/06/2014, 22:20

8 391 0
Báo cáo y học: "A quantitative evaluation of gross versus histologic neuroma formation in a rabbit forelimb amputation model: potential implications for the operative treatment and study of neuromas" ppt

Báo cáo y học: "A quantitative evaluation of gross versus histologic neuroma formation in a rabbit forelimb amputation model: potential implications for the operative treatment and study of neuromas" ppt

... cross-sectional area at the distal end was 3.2 times greater in the amputation group than in the control group (p < 0.0001), and at mm proximally, the cross-sectional area for the amputated radial nerve ... examination of the amputated nerve stumps revealed traumatic neuroma tissue that was enlarged with nodular fusiform formation at the distal end of each of the transected nerves Fibrosis was also ... end-neuroma formation [35] An amputation model was created to better simulate the clinical scenario of limb amputation, as well as to increase the number of neuromas created per animal (and thereby...

Ngày tải lên: 10/08/2014, 10:20

10 434 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

... were as follows: EGFR gene forward primer, 5' -CGAGGGCAAATACAGCTTTG -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters ... dsRNA-EGFR indicated that dsRNA-EGFR is a more fascinating candidate for further development into a better therapy Clearly, for the development of such a therapeutic strategy for clinical use, a ... Sciences) for h at 37 °C The cells were then washed and stained with FITC-conjugated rabbit anti-mouse antibody (Antibody Diagnostic Inc., Shanghai) and left for incubation in the dark After 45 min, the...

Ngày tải lên: 14/08/2014, 19:22

12 314 0
Dirty industry migration and the environment   china as a major case for study

Dirty industry migration and the environment china as a major case for study

... hypothesis derives from classical theories of comparative advantage It regards the environmental standard of a country as an important factor which shapes the country’s comparative advantage ... What international and domestic regulations on dirty industry migration are available? Are they adequate, fair, and effective? Other than the international and domestic regulation of DIM, what ... toxins, hazardous wastes, and radioactive materials and demands that all past and current producers be held strictly accountable to the people for detoxification and the containment at the point...

Ngày tải lên: 14/09/2015, 18:30

412 904 0
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI   by   Dinh Huu Son

A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son

... involves the transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's ... payment card vouchers These mechanisms have various characteristics, such as the extent to which the parties are identified, the traceability of the transaction, and the taxability of the transaction ... permanently It has another advantage to attract tourists It is the location advantage Due to the fact that there is only international airport, which is Noibai airport, in the North of Vietnam...

Ngày tải lên: 07/04/2013, 23:51

58 472 0
Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx

... a = aa = a a = ⎛ a ⎝ b⎠ b3 a × a × a = aaa = a a × b = ab a b = ( ab ) = ⎛ 1⎞ = a – -⎝ a a3 a2 a3 = a2 + = a5 ( a2 )3 = a2 × = ( a3 )2 = a6 a4 ÷ a3 = a4 – = a a + b = ( a + b ) ( a – ab ... Addition:When adding two complex numbers, the real parts and imaginary parts are added separately, the real parts added to real parts and the imaginary to imaginary parts Thus, Copyright 2004, Industrial ... a0 = a – b = ( a – b ) ( a + ab + b ) a2 – b2 = ( a + b ) ( a – b ) ( a + b ) = a + 3a b + 3ab + b a a 3 3 3 a – b = ( a – b ) + 3ab ( a – b ) a a = a 2 a + b = ( a + b ) – 3ab ( a + b ) a b...

Ngày tải lên: 15/12/2013, 03:15

3,3K 636 2
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

... the input component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a ... the lack of software that exploits the advantages of this new generation of devices Thus, the user interface for CAD programs has remained essentially the mouse/keyboard/menu paradigm The availability ... orientation tracking of a user's head and/or hand These data are then used to update the virtual world scene The tracker is sometimes also used to track the user's hand position (usually wearing a...

Ngày tải lên: 23/01/2014, 07:20

10 634 1
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... national, regional or local level, and to cooperate with similar fora at national level At the same time, the Platform can create input for integrating the responses to the obesity challenge into a ... multi-stakeholder approaches5 - for which the European Platform for Action on Diet, Physical Activity and Health (cf section IV.1) is a prominent example - and for action at local, regional, national...

Ngày tải lên: 14/02/2014, 13:20

22 704 0
Tài liệu Commodity-Linked Bonds: A Potential Means for Less-Developed Countries to Raise Foreign Capital doc

Tài liệu Commodity-Linked Bonds: A Potential Means for Less-Developed Countries to Raise Foreign Capital doc

... Monetary and Financial Analysis Department Bank of Canada Ottawa, Ontario, Canada K 1A 0G9 jattamensah@bankofcanada.ca The views expressed in this paper are those of the author No responsibility for ... Bank of Canada Working Papers Documents de travail de la Banque du Canada Working papers are generally published in the language of the author, with an abstract in both official languages Les ... borrower may be given the option to pay the minimum of the face value and the value of the reference amount of the commodity at the maturity date In this paper, two approaches are taken to examine the...

Ngày tải lên: 16/02/2014, 02:20

43 870 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

... [KSb] for the general case which may have DA = DB In that case we had simple random walks {S η }t≥0 with jump rate Dη for η ∈ {A, B}, and there were two paths associated with each initial particle ... A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason why the case DA = DB is special We proved in [KSb] that on a certain ... same distribution at the space-time point (x + y, t + s) as the full-space process (started at (0, 0)) at the point (y, s) Again we shall use the same random walk paths A for all the full-state...

Ngày tải lên: 16/02/2014, 06:20

67 490 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

... one species from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different ... such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria are plant-cells, they must imbibe[Pg 6] their ... differentiated, and that is, that practically all of them are capable of producing their characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere...

Ngày tải lên: 16/02/2014, 22:20

201 541 0
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

... of national data on current employment and the ability to link these data to higher-education databases makes it easier to gather this data today To further leverage these advances, a mechanism ... business and economic activity and the very lifeblood of global capital markets The term “accounting information” encompasses financial and nonfinancial information about the activities, performance, and ... difficult to obtain Recent advances in the coverage and accessibility of national data on employment and the ability to link these data to higher-education databases are starting to alleviate this condition...

Ngày tải lên: 18/02/2014, 01:20

140 391 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management.") ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic reality created by targets and environments...

Ngày tải lên: 18/02/2014, 02:20

14 780 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... compared to h: *P < 0.05; **P < 0.01 sion number AAG09721) are located adjacently in a head-to-head orientation, and their transcription start sites are  1.5 kb apart We therefore analyzed the ... Kitamuro T, Takahashi K, Ogawa K, Udono-Fujimori R, Takeda K, Furuyama K, Nakayama M, Sun J, Fujita H, Hida W et al (2003) Bach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1 gene ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...

Ngày tải lên: 19/02/2014, 06:20

12 622 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt

... equal, canceling the negative subgraph with a positive graph of the same absolute value (see below for an example) Therefore, only damped oscillations can be obtained in such a case Additional ... necessary for the negative graph to induce sustained oscillations We shall analyze the steady states, because the presence of steady states on the phase-space border and the irreversible steady-state ... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in this system can...

Ngày tải lên: 19/02/2014, 16:20

11 639 0
140 CHARACTERS A Style Guide for the Short Form

140 CHARACTERS A Style Guide for the Short Form

... Minimize adverbs and articles Commas are a favor to the reader, not always necessary Eliminate personal pronouns When all else fails, invent a tag .A great tag works as the target of a search, and also ... communication is ubiquitous and instantaneous Those same features are also the bane of the medium Interruption and distraction can appear at any time, and anywhere The weakness of short-form communication ... social change Today, a transformation is happening Short messaging services, and the rich media applications that magnify them, are augmenting society one layer at a time Superfluous, outmoded forms...

Ngày tải lên: 19/02/2014, 21:22

210 3,1K 0
w