a potential biomarker for ptsd

Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

... power of our statistical analysis and make our data vulnerable to a statistical type II error Therefore, our data not allow for advocating complement serum levels as a new biomarker until definitively ... the traditional activation cascade using C3 convertases or C5 convertases [13] As a result, C 5a may be generated via thrombin-mediated coagulation abnormalities that have been documented in anorexia ... severe forms of anorexia nervosa Upon primary medical stabilization, patients are transferred to a psychiatrically based inpatient eating disorder program further treatment and follow-up Patients and...

Ngày tải lên: 09/08/2014, 01:21

6 441 0
Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

... of randomization) and daily through to study day A central laboratory (Covance Central Laboratory Services, Indianapolis, IN, USA) performed all assays The PC activity assay was performed on a ... the treatment effect due to DrotAA therapy for each potential biomarker at baseline Illustration of 28-day mortality RR reduction (DrotAA versus placebo) for each potential biomarker at baseline ... they had a baseline PC measure Day PC was classified as end of infusion If day measurement was not available, last observation carried forward values were used for classification These data were...

Ngày tải lên: 13/08/2014, 08:21

11 343 0
Tài liệu Commodity-Linked Bonds: A Potential Means for Less-Developed Countries to Raise Foreign Capital doc

Tài liệu Commodity-Linked Bonds: A Potential Means for Less-Developed Countries to Raise Foreign Capital doc

... Monetary and Financial Analysis Department Bank of Canada Ottawa, Ontario, Canada K 1A 0G9 jattamensah@bankofcanada.ca The views expressed in this paper are those of the author No responsibility for ... Ottawa, Ontario K 1A 0G9 E-mail: publications@bankofcanada.ca Web site: http://www.bankofcanada.ca Diffusion des publications, Banque du Canada 234, rue Wellington, Ottawa (Ontario) K 1A 0G9 Adresse ... Bank of Canada Working Papers Documents de travail de la Banque du Canada Working papers are generally published in the language of the author, with an abstract in both official languages Les...

Ngày tải lên: 16/02/2014, 02:20

43 870 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... of anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purification of FN3d–AP was carried out using an AKTA ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated...

Ngày tải lên: 19/02/2014, 05:20

14 670 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae ... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana ... gyrans (B), Laminria japonica (C) and Undaria pinnatifida (D) with antibodies raised against various extrinsic proteins Lane 1, anti-(H-PsbP); lane 2, anti-(H-PsbQ); lane 3, anti-(G-PsbQ); lane...

Ngày tải lên: 23/03/2014, 15:21

11 503 0
Báo cáo y học: "tatin-induced expression of CD59 on vascular endothelium in hypoxia: a potential mechanism for the anti-inflammatory actions of statins in rheumatoid arthritis" pptx

Báo cáo y học: "tatin-induced expression of CD59 on vascular endothelium in hypoxia: a potential mechanism for the anti-inflammatory actions of statins in rheumatoid arthritis" pptx

... UK) Statistical analysis All data were expressed as the mean of the individual experiments ± the standard error of the mean Data were analysed using one-way or two-way analysis of variance with ... Capell HA, Sattar N: Trial of Atorvastatin in Rheumatoid Arthritis (TARA): double-blind, randomised placebo-controlled trial Lancet 2004, 363:2015-2021 Palmer G, Chobaz V, Talabot-Ayer D, Taylor ... tissue factor procoagulant activity J Exp Med 1997, 185:1619-1627 36 Collard CD, Agah A, Reenstra W, Buras J, Stahl GL: Endothelial nuclear factor-kappaB translocation and vascular cell adhesion...

Ngày tải lên: 09/08/2014, 08:22

12 510 0
Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf

Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf

... Maldonado-Cocco J, Orozco-Alcala J, Prieur AM, Suarez-Almazor ME, Woo P, International League of Associations for Rheumatology: International League of Associations for Rheumatology classification ... participated in its design and coordination, and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Taschawee Arkachaisri, Daniel ... thermal imaging of the wrist and MCP, normal adult wrists and hands from controls were imaged on separate days Three thermal scans were obtained at each session and the HDI was calculated for each...

Ngày tải lên: 09/08/2014, 10:22

9 345 0
Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx

Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx

... study, ANA staining, saliva collections, data analyses, and manuscript preparation All authors read and approved the final manuscript Proposed genetic predisposition for and fatty acid homeostasis/trans6.NOD-Aec1Aec2 ... O-acyltransferase-1 (SOAT-1) using FCs and free fatty acids (FFAs) ABCA1, ATP-binding cassette, subfamily A [ABC1] member 1; ACAT, acyl-coenzyme A: cholesterol acyltransferase; ApoE, apolipoprotein ... primarily the pathophysiological and biochemical abnormalities that subsequently result in the activation of the autoimmune attack against the submandibular and lacrimal glands [10], is a single...

Ngày tải lên: 09/08/2014, 13:22

12 399 0
Báo cáo y học: "TWEAK: a novel biomarker for lupus nephritis" pot

Báo cáo y học: "TWEAK: a novel biomarker for lupus nephritis" pot

... identified and these are summarised in Table All of these potential biomarkers are more sensitive at identifying renal inflammation than the standard assays (serum creatinine, proteinuria, double-stranded ... injury; as such, they cannot supplant repeat renal biopsies None of the potential biomarkers are specific for LN, as they can be upregulated in other forms of renal inflammation and may increase as ... [8] Antimicrobial protein and siderophore 35 paediatric patients, 18 with renal disease Urinary NGAL associated with renal disease and chronic damage (90% sensitivity) Not as strongly associated...

Ngày tải lên: 09/08/2014, 14:22

3 337 0
Báo cáo khoa học: "Combined effects of hyperglycemic conditions and HIV-1 Nef: a potential model for induced HIV neuropathogenesis" docx

Báo cáo khoa học: "Combined effects of hyperglycemic conditions and HIV-1 Nef: a potential model for induced HIV neuropathogenesis" docx

... Pradhan L, Ali M, Agrawal KC: HAART drugs induce oxidative stress in human endothelial cells and increase endothelial recruitment of mononuclear cells: exacerbation by inflammatory cytokines and ... cytokines and amelioration by antioxidants Cardiovasc Toxicol 2004, 4:287-302 Gomez-Vera J, de Alarcon A, Jimenez-Mejias ME, Acosta D, Prados D, Viciana P: Hyperglycemia associated with protease inhibitors ... hyperplasia Pediatr Dev Pathol 2004, 7:370-379 Sacktor N, Haughey N, Cutler R, Tamara A, Turchan J, Pardo C, Vargas D, Nath A: Novel markers of oxidative stress in actively progressive HIV dementia...

Ngày tải lên: 12/08/2014, 04:20

14 250 0
Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf

Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf

... years Potential confounders of age, gender, BMI, and tibial plateau area for annual change in cartilage volume were included in multivariate analyses A P value less than 0.05 (two-tailed) was regarded ... Medial compartment Annual change in cartilage volume Cartilage defects progress vs no change Lateral compartment Annual change in cartilage volume Cartilage defects progress vs no change Annual ... coefficients of variation for the medial and lateral tibial cartilage volume measures were 3.4% and 2.0% respectively [35,36] Annual change in cartilage volume was calculated as follow up cartilage volume...

Ngày tải lên: 12/08/2014, 11:22

8 372 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot

Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot

... plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; ... the E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the 3' primer used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified ... essential for Vif function J Biol Chem 2005, 280(19):18573-18578 Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H, Iwai K, Uchiyama...

Ngày tải lên: 13/08/2014, 05:21

13 254 0
Báo cáo y học: "Expression of infectious murine leukemia viruses by RAW264.7 cells, a potential complication for studies with a widely used mouse macrophage cell line" ppsx

Báo cáo y học: "Expression of infectious murine leukemia viruses by RAW264.7 cells, a potential complication for studies with a widely used mouse macrophage cell line" ppsx

... formalin fixed, paraffin embedded tissues or studied by IHC using the anti-p30 antibody, anti-CD3 for Tcell lineage identification (DAKO Corporation, Carpinteria, CA Catalog # A4 52), and anti-PAX5 ... anti-PAX5 for B-cell lineage (Goat anti-Pax 5, Santa Cruz Biotechnology, Santa Cruz, CA, Catalog #sc-1974) [14] Criteria for histopathological diagnosis were as described [15] As shown in Table 1, ... pneumonia virus of mice (PVM) in a mouse macrophage cell line Virol Journal 2007, 4:48-51 Shin J-J, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang J-I, Rebres R, Roach T, Seaman W, Simon MI, Fraser...

Ngày tải lên: 13/08/2014, 06:20

6 330 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot

... denaturation at 94°C for 10 s annealing at 53°C for 30 s and extension at 72°C for 40 s, followed by a final extension at 72°C for 10 The relative amount of EGFR cDNA in each sample was calculated by ... -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters included one cycle at 94°C for min, and 45 cycles involving denaturation ... 5'GGAGCUGCCCAUGAGAAAUdTdT-3' and antisense 5'AUUUCUCAUG GGCAGCUCCdTdT-3' The unrelated nonspecific dsRNAs as control were designed as following: sense 5'-GAACUUCAGGGUCAGCUUG CCdTdT-3' and antisense 5'-GGCAAGCUGACCCUGAAGUUCdTdT3'...

Ngày tải lên: 14/08/2014, 19:22

12 314 0
BARRIER DISRUPTION IN STAT6VT TRANSGENIC MICE AS A POTENTIAL MODEL FOR ATOPIC DERMATITIS SKIN INFLAMMATION

BARRIER DISRUPTION IN STAT6VT TRANSGENIC MICE AS A POTENTIAL MODEL FOR ATOPIC DERMATITIS SKIN INFLAMMATION

... technical aspects of this project For Dr Ravi Sahu, Dr Mohammed Al-Hassani, Dr Sarita Sehra, Dr Simarna Kaur, Qiaofang Yi, Davina A Lewis, Badri M Rashid, Evelyn T Nguyen, and Pamela Durant And finally, ... Sarasour, et al., 1995) The radial spread of SLS can elicit increased TEWL and decreased skin capacitance in areas adjacent to the application sites, as far as approximately 0.75cm away (Patil, ... of asthma and allergic diseases The IL-4 pathway cascade is mediated through the activation of the latent transcription factor, signal transducer and activator of transcription (STAT6) The STAT...

Ngày tải lên: 24/08/2014, 12:37

50 208 0
Hydrogen peroxide as a potential biomarker of oxidative stress is there a reliable assay

Hydrogen peroxide as a potential biomarker of oxidative stress is there a reliable assay

... of HVA in the presence of HRP to a fluorescence dimer 69 3.11 A standard calibration plot for the HVA assay 70 3.12 A standard calibration plot for the HPAA assay 74 3.13 Structure of ABTS and ... inflammatory responses (Valko et al., 2007) Fig 1.3 gives a diagrammatic summary of the activation of MAPK signaling pathways ROS production by activated neutrophils and macrophages is a vital ... oxidative stress/damage isolated from tissues and biological fluids Biomarkers are defined as characteristics that can be objectively measured and evaluated as indicators of normal biological...

Ngày tải lên: 22/10/2015, 21:14

165 397 0
A potential target for tuberculosis drug discovery

A potential target for tuberculosis drug discovery

... Clp ATPase belongs to the AAA+ superfamily of ATPases AAA+ proteins are generally modulated by a group of otherwise unrelated proteins termed adaptor proteins An adaptor protein serves as an accessory ... the same group demonstrated that mpa and pafA mutants are severely attenuated in a mouse model of infection (Darwin et al., 2005) Mpa is an ATPase that forms hexamers like the Clp ATPase Meanwhile, ... adds 11 amino acid tag (AANDENYALAA) to the incomplete protein Proteins tagged with the SsrA peptide are targeted for degradation The C-terminal Ala-Ala residues are critical for SsrA recognition...

Ngày tải lên: 26/11/2015, 22:38

114 215 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of...

Ngày tải lên: 03/11/2012, 10:52

8 503 0
A Generic QSAR for Assessing the Bioaccumulation Potential of Organic Chemicals in Aquatic Food Webs pot

A Generic QSAR for Assessing the Bioaccumulation Potential of Organic Chemicals in Aquatic Food Webs pot

... this class of chemical substances a reasonable database exists that can be used for calibration Also, similar mechanisms for metabolic transformation may apply to this class of chemical substances ... the same parameters to tropical or arctic food webs Model calibration: To calibrate the model, a database was compiled of empirical BCF and BAF data for organic chemicals in fish and aquatic ... unable to predict metabolic transformation rates of chemical substances in aquatic biota However, if information on metabolic transformation rates are available from laboratory bioconcentration...

Ngày tải lên: 22/03/2014, 14:20

9 717 0
Báo cáo hóa học: " Cathepsin B: a potential prognostic marker for inflammatory breast cancer" ppt

Báo cáo hóa học: " Cathepsin B: a potential prognostic marker for inflammatory breast cancer" ppt

... Hoda Ismail (Department of Pathology, National Cancer Institute, Cairo University, Giza, Egypt) for her assistance in reviewing and scoring of pathology slides We also thank Ms A Dhiaa Alraawi and ... rafts and caveolin-1 are required for invadopodia formation and extracellular matrix degradation by human breast cancer cells Cancer Res 2009, 69:8594-8602 Mohamed MM, Cavallo-Medved D, Sloane ... Lejeune C, Romain S, Tubiana N, Beedassy B, Martin PM, Serment H, Piana L: Inflammatory carcinomas of the breast: a clinical, pathological, or a clinical and pathological definition? Int J Cancer 1995,...

Ngày tải lên: 18/06/2014, 16:20

8 424 0
w