... parameters in detail Second, we plan to appreciably enhance the integrated model It appears from both our initial data analysis, as well as our qualitative examination of the data, that the pairs ... M., Mampilly, T., Sharma, V., et al (200 5a) Natural noun phrase variation for interactive characters In Proceedings of 1st Annual Artificial Intelligence and Interactive Digital Entertainment ... may benefit from a datadriven model of how collaborative pairs adapt their language in the presence (or absence) of shared visual information A successful computational model of referring behavior...
Ngày tải lên: 24/03/2014, 03:20
... Expression and reactivation of HIV in a chemokine induced model of HIV latency in primary resting CD4+ T cells Suha Saleh1,2, Fiona Wightman1,2, Saumya Ramanayake1, Marina Alexander3, Nitasha Kumar1,2, ... this model, as measured by Ki67 staining and dilution of carboxyfluorosceinsuccinate (CFSE) (data not shown) The exact mechanism of action of IL-7 in our CCL19-induced model of latency remains ... different models of latency in primary Tcells Others have demonstrated the synergism obtained by treatment with a combination of prostratin and the HDACi vorinostat in both a cell line and primary...
Ngày tải lên: 13/08/2014, 01:21
a one-dimensional model of blood flow in arteries with friction, convection and unsteady taylor diffusion based on the womersley velocity profile
Ngày tải lên: 13/11/2014, 10:12
Báo cáo y học: "Human, viral or mutant human IL-10 expressed after local adenovirus-mediated gene transfer are equally effective in ameliorating disease pathology in a rabbit knee model of antigen-induced arthritis" ppt
... the adenoviral vectors and analysis in the rabbit model of AIA and AK wrote the initial draft of the manuscript JN and ZM assisted in the therapeutic analysis in the rabbit model PDR conceived of ... EDTA and 0.4 M sodium acetate, pH 5.2 This papain solution (100 µl) was added to 100 µl of lavage fluid supernatant and incubated overnight at 60°C Papain was then inactivated by iodoacetic acid ... principal function of IL-10 appears to be anti-inflammatory, limiting and eventually terminating inflammatory responses by inhibiting synthesis of monocyte and macrophage derived pro-inflammatory...
Ngày tải lên: 09/08/2014, 08:22
Tài liệu Báo cáo khoa học: "A Shallow Model of Backchannel Continuers in Spoken Dialogue" potx
... tagging and statistical parsing, this can be at least partly explained by the fact that humans vary widely in how many of their opportunities for placing a backchannel continuer they actually realize ... processing and information that is readily available to current spoken dialogue systems Pause duration and a statistical part -of- speech language model were examined A method combining these two models ... if increasing the number of factors used in prediction would significantly improve the coverage whilst also maintaining a high accuracy A continuer was inserted after the occurrence of any of...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function potx
... in a murine model of Hermansky–Pudlak syndrome Am J Physiol Lung Cell Mol Physiol 285, L643–L653 Nakatani Y, Nakamura N, Sano J, Inayama Y, Kawano N, Yamanaka S, Miyagi Y, Nagashima Y, Ohbayashi ... morphology ⁄ appearance within larval intestinal cells These data show that increased osmolarity can rapidly and substantially reduce the number of vacuoles in umps-1(zu456) larvae Accumulation of orotic ... plates containing E coli expressing dsRNA against the listed gene g Embryos from parents containing extrachromosomal arrays were scored Owing to lack of segregation of the arrays, not all of...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: "A Computational Model of Text Reuse in Ancient Literary Texts" potx
... listed in Table 2, yielding two models, B and J Table shows the increasing accuracy of both models in describing the text reuse in Ltrain as more features are incorporated The Block feature contributes ... definitive answers, it can serve as a supplement to linguistic and literary-critical approaches to text-reuse analysis, and can be especially helpful when dealing with a large amount of candidate source ... follows the Markan narrative in his own gospel he follows painstakingly the Markan order”, and hence “deviations in the order of the material must therefore be regarded as indications that Luke is...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo khoa học: "Multiple Interpreters in a Principle-Based Model of Sentence Processing" potx
... the schema of a particular representation provides a formal characterisation of locality Just as phrase structure is defined in terms of branches, we can define Chains as a sequence of links More ... structures are limited to some combination of binary (non-terminal) and unary (terminal) branches As discussed above, we can characterise the representational framework in terms of nodes and schemas: ... relevant features (such as L-marking, Case, and 0) If we adhere to the representational paradigm used above, we can define Chains in the following manner: Chain Schevaa Node: C-Node: {Cat,Level,Pos,ID,Ftrs}...
Ngày tải lên: 18/03/2014, 02:20
Towards a Model of Information Aesthetics in Information Visualization pdf
... represent a certain dataset The model aims to facilitate an understanding of information aesthetics from the perspective of information visualization and visualization art, in its intentions and used ... by a growing online community who encourage creativity and sharing Dataset Availability The Internet has made the individual creation, collection and sharing of data easier Next to personal content ... treated as a means of attracting and maintaining user engagement so that the visualization – often a commercial tool – increases in popularity On the other hand, there are some techniques which place...
Ngày tải lên: 23/03/2014, 13:20
báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx
... were always assayed at the same time and in the same way All samples were always determined in triplicate and in a blind fashion Immunoblot analysis An aliquot of brain homogenates was electrophoresed ... outlined anatomical area in the image, as previously described [9,16,17] Analyses were always performed in a coded fashion Statistical analysis Data are expressed as mean ± standard error of mean ... internal standard is added to each sample, after solid phase extraction samples are derivatized and purified by thin layer chromatography, and finally analyzed An aliquot of these extracts was...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo lâm nghiệp: "Evaluation through a simulation model of nutrient exports in fast-growing southern European pine stands in relation to thinning intensity and harvesting operations" doc
... depending on thinning intensities for radiata pine and maritime pine Pinus radiata Intensity of thinning First thinning Pinus pinaster Second thinning First thinning Second thinning % of trees ... study was to calculate the accumulation and the export of nutrients over time in Pinus pinaster (maritime pine) and Pinus radiata (radiata pine) stands under a range of silvicultural alternatives, ... to soil as logging residues due to thinnings and clear-cutting as a function of thinning intensity and site quality for radiata pine stands, in the case of conventional harvesting (no debarked...
Ngày tải lên: 07/08/2014, 16:21
Báo cáo khoa học: "Consequences of reducing a full model of variance analysis in tree breeding experiments" pps
... orthogonal, analyses of data (height in 1983) were performed in France using the Amance ANOVA programs (Bachacou et al., 1981) Furthermore, the number of factor levels was larger than the computer capacity, ... (within locality) variance components remain unaffected (table IV) Provenance and provenance-locality variance components are increased respectively by the smallest part of family and family-locality ... other equalities of sums of squares To summarize, when we decide to speak of families only, instead of provenances and families (within provenances), we obtain the following changes in variance components:...
Ngày tải lên: 09/08/2014, 03:24
Báo cáo y học: "Intra-articular injection of recombinant TRAIL induces synovial apoptosis and reduces inflammation in a rabbit knee model of arthri" pdf
... report, we have examined the ability of rTRAIL to induce synovial apoptosis in vivo in inflamed rabbit knee joints following intra-articular injection Similar to the effects of intra-articular injection ... joints, the shaved cartilage (rTRAIL) under synovial lining was sectioned for evaluation of cartilage structure Histological examination of hematoxylin and eosin (H&E) and TUNEL stained cartilage ... the saline control Determination of glycosaminoglycan synthesis in cartilage To assess the possible impact of rTRAIL on the articular cartilage, small pieces of articular cartilage were shaved...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "roteoglycan 4 downregulation in a sheep meniscectomy model of early osteoarthritis" docx
... proteoglycan Regional 0 6A1 0 in ovine tibial plateau cartilage (PRG4) with polyclonal antibody 0 6A1 0 in ovine tibial plateau cartilage Lateral and medial tibial plateaux (LTP and MTP, respectively) ... generated from plasmids (pGEM Teasy; Promega, Sydney, Australia) containing the PCR products, and the linear amplification range for both plasmid DNA and sample cDNA was determined Analysis of ... study we have demonstrated in an animal model that early degeneration of cartilage was associated with the loss of PRG4 from articular cartilage concomitant with a significant decrease in its expression...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt
... TGGCTGTTTCTGGCTGTTACTG and AATCAGCAGCGACTCCTTTTCC; IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC; β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGATGTCACGCACGATTTCC Statistical analysis ... Laboratory Animal Center (Shizuoka, Japan) All mice were maintained in a pathogen-free facility at the Hyogo College of Medicine Animal experiments were done in accordance with the guidelines of the National ... I, Tomita N, Moriguchi A, Maeda K, Sawa Y, Kaneda Y, Higaki J, et al.: In vivo transfection of cis element "decoy" against nuclear factor-κB binding site prevents myocardial infarction Nat Med...
Ngày tải lên: 09/08/2014, 08:22
báo cáo khoa học: "Therapeutic activity of two xanthones in a xenograft murine model of human chronic lymphocytic leukemia" doc
... treated with daily iv injections (0.2 ml in saline) on days to (arrows) of mg/kg of allanxanthone C (black triangle) or macluraxanthone in DMSO (white square) or of solvent (DMSO in saline) alone ... Experiments examining the effects of increasing doses and time of treatment as well as different schedules of administration are in progress in order to improve the therapeutic efficacy of the two xanthones ... the data and revised the manuscript; CBi interpreted the data and wrote the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have...
Ngày tải lên: 10/08/2014, 22:21
Báo cáo y học: "A dynamic model of gene expression in monocytes reveals differences in immediate/early response genes between adult and neonatal cells" potx
... physiologic modelling is another means of corroborating array findings and provides the advantage of providing an approach for immediately testing the biological relevance of microarray data before embarking ... 0.05 was considered statistically significant for all analyses Analysis of the apoptosis assays was undertaken using both parametric and non-parametric analysis methods Parametric analysis was undertaken ... technique, was used to determine and spatially map gene-to-gene interactions [21] All statistical analysis was performed in Matlab R14 (Natick, MA) and Statistica v7 (Tulsa, OK, USA) An alpha level of...
Ngày tải lên: 11/08/2014, 08:21
báo cáo khoa học: " A systems biology model of the regulatory network in Populus leaves reveals interacting regulators and conserved regulation" potx
... large transcriptomics programs have generated adequate quantities of high-quality data to enable systems analysis [6] For example, Carerra et al [4] modeled the transcriptional network of Arabidopsis ... across a large collection of leaf transcriptomics data and found that some network hubs have existing functional evidence in Arabidopsis; Quesada et al [14] performed a comparative analysis of ... not part of at least one bootstrap sample We also investigated the stability of the regulations by calculating the fraction of bootstrapped networks that contained each edge in the original network...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt
... http://arthritis-research.com/content/12/3/R93 Competing interests Mohamad Navab and Alan M Fogelman are principals in Bruin Pharma and Alan M Fogelman is an officer in Bruin Pharma The remaining authors ... class A amphipathic helical peptide J Lipid Res 2001, 42:1096-1104 Navab M, Anantharamaiah GM, Hama S, Garber DW, Chaddha M, Hough G, Lallone R, Fogelman AM: Oral administration of an Apo A- I ... mice was analyzed for 69 chemokines and cytokines using Luminex-based beadarray L-4F treatment resulted in a trend toward decreased levels of tissue damage and inflammation indicators, including...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: "Heliox improves pulmonary mechanics in a pediatric porcine model of induced severe bronchospasm and independent lung mechanical ventilation" pdf
... in a higher resistance than laminar flow In addition, mechanical ventilation may further complicate the management of acute severe asthma by delivering a gas with increased velocity through a ... 07:00 Page 66 Critical Care 1999, Vol No and anti-inflammatory agents have become the standard of care for reactive airway disease and asthma However, some patients fail to respond to aggressive ... a narrow endotracheal tube, particularly in pediatric and neonatal patients This increases the Reynolds number, which indicates greater turbulent flow and airway resistance Adequate ventilation...
Ngày tải lên: 12/08/2014, 18:20