a permanency of the internal audit function

Consultative document The internal audit function in banks pptx

Consultative document The internal audit function in banks pptx

... discoveries of fraud and violations of laws and regulations as raised by the head of the internal audit function; (l) approving the audit charter and the code of ethics of the internal audit function; ... International Auditing and Assurance Standards Board, and the standards of The Institute of Internal Auditors (The IIA) as indicated The diagram does not reflect all of the communication channels ... information acquired The internal audit function in banks 21 The head of the internal audit function and all internal auditors should avoid conflicts of interest Internally recruited internal auditors...

Ngày tải lên: 06/03/2014, 10:20

27 460 0
The internal audit function in banks docx

The internal audit function in banks docx

... internal audit staff within the internal audit function In addition, a bank may rotate staff from other functional areas of the bank to the internal audit function or from the internal audit function ... discoveries of fraud and violations of laws and regulations as raised by the head of the internal audit function; (l) approving the audit charter and the code of ethics of the internal audit function; ... integrity The internal audit function in banks The internal audit charter Principle 5: Each bank should have an internal audit charter that articulates the purpose, standing and authority of the internal...

Ngày tải lên: 06/03/2014, 10:20

29 539 0
Báo cáo " Characteristics of Quaternary sedimentary facies in relation to water bearing capacity of aquifers and aquicludes in the Red River Delta, Vietnam " ppt

Báo cáo " Characteristics of Quaternary sedimentary facies in relation to water bearing capacity of aquifers and aquicludes in the Red River Delta, Vietnam " ppt

... mixed  with  sand  of deltaic  facies  and  silty  clay  of lagoonal  facies  in  the central  part  passing  into  silty clay of flood plain, oxbow, coastal swamp  and peat facies in the direction from the plain to  ... and peat facies in the direction from the plain to  the modern  coastline.  The fourth  sequence  consists of swamp clay, lagoonal clay and peat.  In the direction towards the center of the plain,  each of these sequences appears more and more  ... tidal flat silty sand and lagoonal clay and lenses  of lacustrine  clay  of Hanoi  Formation,  the laterized lagoonal clay of Vinh Phuc Formation,  the alternating  greenish  gray  clay  and  peat  bearing  swamp  clayey ...

Ngày tải lên: 28/03/2014, 15:20

7 672 0
Báo cáo y học: "Variety of transversus thoracis muscle in relation to the internal thoracic artery: an autopsy study of 120 subjects" docx

Báo cáo y học: "Variety of transversus thoracis muscle in relation to the internal thoracic artery: an autopsy study of 120 subjects" docx

... here was gathered in the course of fresh cadaver autopsies carried out in the Department of Forensic Medicine at the Medical University of Sofia, Bulgaria The medico-legal office and local Ethic ... data on the transversus thoracis variations are scarce in literature Data concerning the level of slip attachment and scope of the transversus thoracis, irrespective of the side examined, have ... right bare area is larger and reaches the level of third rib and intercostal space Conclusions The data from the present study adds some basic information concerning the surgical anatomy of the anterior...

Ngày tải lên: 10/08/2014, 09:23

6 491 0
Báo cáo y học: " In vivo imaging of the airway wall in asthma: fibered confocal fluorescence microscopy in relation to histology and lung function" potx

Báo cáo y học: " In vivo imaging of the airway wall in asthma: fibered confocal fluorescence microscopy in relation to histology and lung function" potx

... biopsies’ of the airway wall are obtained by placing the tip of the miniprobe onto the airway wall surface Another advantage of FCFM and its miniprobe is the ability to reach and therefore visualize the ... Mixed Asthma Lamellar Lamellar Healthy, atopic Mixed Mixed Healthy, atopic Mixed Lamellar 10 Healthy, atopic Lamellar Lamellar 11 Healthy, atopic Lamellar Lamellar 12 Healthy, non-atopic Wispy real-time ... Additional oxygen through an intranasal catheter was given to the participant when necessary Immediately after adequate local anaesthetic the bronchial tree was inspected with an autofluorescence...

Ngày tải lên: 12/08/2014, 13:22

9 406 0
LEGENDS OF BABYLON AND EGYPT IN RELATION TO HEBREW TRADITION doc

LEGENDS OF BABYLON AND EGYPT IN RELATION TO HEBREW TRADITION doc

... commemorating Taba, daughter of Tahapi, an Aramaean lady who was also a convert to Osiris It is rather later than that of Abbâ and his wife, since the Aramaic characters are transitional from the archaic ... depression of the Jordan Valley, the Dead Sea, and the 'Arabah The Judaean hills and the mountains of Moab are merely the southward prolongation of the Lebanon and Anti-Lebanon, and their neighbourhood ... (5) The name of the father of Gilgamesh is rather strangely expressed by the single sign for the vowel a and must apparently be read as A As there is a small break in the text at the end of this...

Ngày tải lên: 29/03/2014, 02:21

181 297 0
báo cáo hóa học: " Incidence of Raynaud''''s phenomenon in relation to hand-arm vibration exposure among male workers at an engineering plant a cohort study" doc

báo cáo hóa học: " Incidence of Raynaud''''s phenomenon in relation to hand-arm vibration exposure among male workers at an engineering plant a cohort study" doc

... study, was the examining physician at the baseline and the follow ups, participated and contributed substantial in the analysis and in the interpretation of data Acknowledgements This research was ... effects of hand-arm vibration exposure below m/ s2 In a study of car mechanics 15% had VWF with an average daily exposure duration of 14 minutes at a value of 3.5 m/s2 and an average total exposure ... we used the age 16 as onset of exposure time In vocational school the two last years are to a major part practice There was no worker that got out of hand-arm vibration exposure and then returned...

Ngày tải lên: 20/06/2014, 00:20

6 340 0
Báo cáo y học: "Assessment of sperm quality traits in relation to fertility in boar semen" ppt

Báo cáo y học: "Assessment of sperm quality traits in relation to fertility in boar semen" ppt

... Acta Veterinaria Scandinavica 2009, 51:53 tor testicular function of boars and bulls as spermatozoa are not analyzed in terms of their total integrity [2-4] Assessment of sperm plasma membrane ... Veterinaria Scandinavica 2009, 51:53 Acknowledgements The authors thank Mrs R Ijäs for technical assistance and Mr K Ala-Juusela for providing insemination data and the boar stations Pro Agria Jalostuspalvelu ... two-sample analysis, and Spearman rank correlations were calculated The Spearman rank correlations were used to calculate the relationships between the sperm quality traits and fertility Relationship...

Ngày tải lên: 12/08/2014, 18:22

6 431 0
Tài liệu Rubber plantation performance in the Northeast and East of Thailand in relation to environmental conditions docx

Tài liệu Rubber plantation performance in the Northeast and East of Thailand in relation to environmental conditions docx

... Malaysia Rest of Asia Africa South America Others 1676; 20 % Figure Rubber plantation area in the world in thousand hectares, and percentage of the total planted area in the world in the year ... In Thailand, the rubber plantation area is larger than the plantation area of these two crops In the year 2005, the plantation areas of rubber, oil palm and coconut were 680 000 ha, 315 000 and ... forests The natural range of Hevea, of the family Euphorbiaceae, covers the Amazon river basin and parts of the nearby uplands Within the genus, Hevea brasiliensis (also known as para rubber)...

Ngày tải lên: 21/02/2014, 04:20

70 815 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

... gene) and quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene) BD, pGBT9; BD*, pAS2-1; AD, pGAD424; AD**, pACT2 Activity values are given as mean values ± standard ... pair of primers: 5¢-CAGGATCCCTATGAGCAGC TCCGAGGAAGTCTCCT-3¢ and 5¢-CTGTCGACTTA GTTTTTCGCTCGTAGTGGCATTTTAAAATTGGCT GC-3¢ BamHI–SalI digested PCR fragment was cloned into BamHI–SalI digested pAS2-1 ... from the DNA of the cosmid clone #9 [18] using the following pair of primers: 5¢-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3¢ To make the b-galactosidase expressing...

Ngày tải lên: 21/02/2014, 15:20

10 465 0
Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc

Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc

... DNA pU6LNS (two lac operators at a distance of 183 bp) was reported A B Fig Relative positions of the three lac operator sites in the plasmid DNAs (A) Diagrammatic representation of the plasmid ... represent chromatin and naked DNA samples of d35 The probe was the same as that in Fig The black dot marks the spot in lane 9, which is an artefact, and asterisks denote the positions of the hypersensitivity ... Ellipses indicate the nucleosomes, and solid boxes represent the R3 footprint over the lac operator Arrowheads and arrows mark the positions of the lac operators The names of the plasmid DNAs are given...

Ngày tải lên: 16/03/2014, 10:20

15 300 0
Báo cáo khoa học: "A CONSIDERATION ON THE CONCEPTS STRUCTURE AND LANGUAGE IN RELATION TO SELECTIONS OF TRANSLATION EQUIVALENTS OF VERBS IN MACHINE TRANSLATION SYSTEMS" doc

Báo cáo khoa học: "A CONSIDERATION ON THE CONCEPTS STRUCTURE AND LANGUAGE IN RELATION TO SELECTIONS OF TRANSLATION EQUIVALENTS OF VERBS IN MACHINE TRANSLATION SYSTEMS" doc

... considerations of space size and realizability on actual data, because we have to check all the combinations of several ten thousands nouns with each verb (i) The only one natural conceptural categories ... equivalent ( D o , Play : ~ - & ) that can be associated in common to a part of the structure of the categories as in Fig.l, and then find appropriate translation equivalents in detail at the ... level categories (2) To each verb found in the process of the association, consults ordinary dictionary of translation equivalents and word usage of verbs and obtain the set of all the translation...

Ngày tải lên: 31/03/2014, 17:20

3 395 0
báo cáo hóa học: " The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" potx

báo cáo hóa học: " The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" potx

... concept and design SR participated in data integration and data analysis accuracy JM and NK were responsible for statistical analysis and data presentation MM completed the interpretation of data GSM ... consisted of a systematic sample (k BMI categorization Based on the reported data on body height and mass, BMI values were calculated as the ratio of body mass in kilograms and the square of height ... quality of life, and particularly the physical health of the individual, coincide with those of other authors who also found that overweight and obesity have a greater impact on physical rather...

Ngày tải lên: 18/06/2014, 19:20

10 535 0
báo cáo hóa học: " Self-reported work ability of Norwegian women in relation to physical and mental health, and to the work environment" ppt

báo cáo hóa học: " Self-reported work ability of Norwegian women in relation to physical and mental health, and to the work environment" ppt

... concept and design and statistical analysis of the data, IS collected the data, BL contributed to the concept and interpretation of the data, DB contributed to the concept, design, statistical analysis ... categories of dependent variable The significance level was set at p < 05 All analyses were performed using STATA, version 8.2 Results The average age of the sample was 43.2 years and the majority ... may indicate that physical and mental health mediates the relationship between job satisfaction and work ability The higher prevalence of physical and mental health problems among the "dissatisfied"...

Ngày tải lên: 20/06/2014, 00:20

9 428 0
báo cáo hóa học:"The role of disclosure in relation to assent to participate in HIV-related research among HIV-infected youth: a formative study" docx

báo cáo hóa học:"The role of disclosure in relation to assent to participate in HIV-related research among HIV-infected youth: a formative study" docx

... Kinshasa, Democratic Republic of the Congo Acknowledgements We thank Tshimanga Badinga, Nicole Kutumbakana, Odette Daiku, Mamie Ilaka, Jean-Serges Kalengi Kukemfuka and Jose Kayumba Baye for their ... caregiver, the maternal aunt and primary caregiver of a 12-year-old girl, described a similar rationale for supporting disclosure at the end of a study: Their participation in the study will serve as a ... objective of the formative study was to develop a culturally appropriate approach for obtaining assent from children aged eight to 17 years to participate in the operational research; the legal age of...

Ngày tải lên: 20/06/2014, 08:20

10 373 0
báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt

báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt

... visual impairment rates and indicators of other eye-care activities, such as number of visits/inhabitant, glaucoma diagnosis campaign, etc Inequality of quality of care could also be a factor ... were available During the 1999 national census a filtering survey called "Everyday Life and Health" was added A total of 2,275 geographical areas were picked at random from the 1990 survey, stratified ... explaining the prevalence rate differences across the regions Unfortunately, such aspects of ophthalmological activity or quality estimates are unavailable in France at a regional level Lastly, the...

Ngày tải lên: 20/06/2014, 15:20

8 445 0
báo cáo hóa học:" General anxiety, depression, and physical health in relation to symptoms of heart-focused anxietya cross sectional study among patients living with the risk of serious arrhythmias and sudden cardiac death" doc

báo cáo hóa học:" General anxiety, depression, and physical health in relation to symptoms of heart-focused anxietya cross sectional study among patients living with the risk of serious arrhythmias and sudden cardiac death" doc

... management of patients with ventricular arrhythmias and the prevention of sudden cardiac death–executive summary: A report of the American College of Cardiology/American Heart Association Task ... general anxiety and depression, whereas avoidance had a stronger association to physical health The interpretation of the role of avoidance is not straight forward Cardio-protective avoidance has ... study and the editing of the article BR contributed to shaping of the article and the editing of the article GEE contributed to the statistical analyses and the editing of the manuscripts KN participated...

Ngày tải lên: 20/06/2014, 15:20

10 454 0
báo cáo hóa học:" The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" docx

báo cáo hóa học:" The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" docx

... concept and design SR participated in data integration and data analysis accuracy JM and NK were responsible for statistical analysis and data presentation MM completed the interpretation of data GSM ... consisted of a systematic sample (k BMI categorization Based on the reported data on body height and mass, BMI values were calculated as the ratio of body mass in kilograms and the square of height ... quality of life, and particularly the physical health of the individual, coincide with those of other authors who also found that overweight and obesity have a greater impact on physical rather...

Ngày tải lên: 20/06/2014, 16:20

10 416 0
Báo cáo lâm nghiệp: "The effect of different stand density on diameter growth response in Scots pine stands in relation to climate situations" potx

Báo cáo lâm nghiệp: "The effect of different stand density on diameter growth response in Scots pine stands in relation to climate situations" potx

... intensity of thinning was set to account for 15–10% of the basal area during the first half of the rotation period (up to the age of 50 years) and for 10–6% of the basal area in the second half of rotation ... (1) The outputs of analysis were residual chronologies (calculated from measured and modelled data) of all individual trees Climate data Mean monthly temperatures (measured at a height of m above ... calculated the long-term mean of monthly average temperatures and total monthly precipitation in accordance with the period of observation (Table 1) Additionally, average temperature and total precipitation...

Ngày tải lên: 07/08/2014, 10:21

13 318 0
w