a paradigm shift from conventional connectionism
From Marketing Mix to Relationship Marketing: Towards a Paradigm Shift in Marketing docx
... Marketing Mix Managing the marketing mix makes marketing seem to easy to handle and organize Marketing is separated FROM MARKETING MIX TO RELATIONSHIP MARKETING: TOWARDS A PARADIGM SHIFT IN MARKETING ... multi-service organizations, Berry[78] views relationship marketing as a strategy to attract, maintain and enhance customer FROM MARKETING MIX TO RELATIONSHIP MARKETING: TOWARDS A PARADIGM SHIFT IN MARKETING ... this paradigm is still strong today In a standard marketing text, services marketing, industrial marketing and international marketing, for example, are touched on in a few paragraphs or they may...
- 17
- 536
- 0
Báo cáo y học: "Conflict and health: a paradigm shift in global health and human rights" ppt
... charge to the entire biomedical community We reaffirm that health is a practical daily concern with political, structural, social as well as biophysical dimensions We encourage participation from ... Editorial Board, Conflict and Health is open-access and freely available to readers around the world In the past, human rights workers, lawyers, health professionals and epidemiologists have chosen ... neglected diseases: a deficient market and a public-health policy failure The Lancet 2002, 359:2188-94 Spiegel P, Le P, Ververs MT, Salama P: Occurrence and overlap of natural disasters, complex...
- 2
- 230
- 0
Báo cáo y học: " The switch from conventional to atypical antipsychotic treatment should not be based exclusively on the presence of cognitive deficits. A pilot study in individuals with schizophrenia" pps
... compare the means (T1 vs T2) for all patients, as well as for each treatment group at T1 In each group, changes in cognitive and clinical scores were analyzed using an analysis of variance (ANOVA) ... between that reached statistical significance, they were entered as covariates in these analyses Pearson correlations were calculated among the clinical, treatment, and outcome variables at T1 and ... distributed under Ltd Psychiatry Access article References Daban C, Martinez-Aran A, Torrent C, Tabarés-Seisdedos R, BalanzaMartínez V, Salazar-Fraile J, Selva-Vera G, Vieta E: Specificity of cognitive...
- 10
- 412
- 0
Tài liệu Retrieving a Single Value from a Query pdf
... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...
- 2
- 312
- 0
Tài liệu Pass a Dataset Back from an XML Web Service docx
... columns from a data table If the goal is to include all the columns in the table and accept the Password column, then when other columns are added, you will not have to touch the code because the ... - - - ... username once again The first table from the returned dataset is assigned to the DataSource property of dgUsers Listing 13.6 frmHowTo13_4.vb: Retrieving a Dataset from a Web Service Private Sub btnLogin_Click(ByVal...
- 4
- 283
- 0
Tài liệu Getting a Sequence Value from Oracle pdf
... creating the sequence Oracle stores the definition of sequences for a database in a single data dictionary table in the SYSTEM table namespace As a result, all sequence definitions are always available ... CommandType.StoredProcedure; // Add the parameters and set values for them cmd.Parameters.Add(ID_PARM, OracleType.Int32).Direction = ParameterDirection.Output; cmd.Parameters.Add(FIELD1_PARM, OracleType.NVarChar, 50); ... generate a sequence of unique values for a primary key column, but is not related to the table containing the column As a result, a sequence generator can generate unique values for more than one...
- 4
- 338
- 0
Tài liệu Voices of Fear and Safety¿ Women¿s ambivalence towards breast cancer and breast health: a qualitative study from Jordan pdf
... “Voices of Fear and Safety” Women’s ambivalence towards breast cancer and breast health: a qualitative study from Jordan Hana Taha1,2,3* Email: hana.taha@ki.se Raeda Al-Qutob4,5 Email: raeda@johud.org.jo ... Foundation, Amman, Jordan Abstract Background Breast cancer is the leading cause of cancer mortality among Jordanian women Breast malignancies are detected at late stages as a result of deferred breast ... physicians in Crete BMC Womens Health 2008, 8:20 28 Lamyian M, Hydarnia A, Ahmadi F, Faghihzadeh S, Aguilar-Vafaie ME: Barriers to and factors facilitating breast cancer screening among Iranian...
- 19
- 513
- 0
Breaking into the Game Industry: Advice for a Successful Career from Those Who Have Done It
... Publisher and General Manager, Course Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions ... of my MFA work—papers, analysis, presentation—but college was an arena to develop other skills like leadership/team management and being a team player I argue that amazing games are near impossible ... games are still alive Some are still making games They have pioneered a great many genres, mastered programming algorithms and design patterns, and have learned to adapt to platform after platform...
- 304
- 1,667
- 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
... alkaline phosphatase gene from hypophosphatasia patients J Bone Miner Res 13, 1827–1834 Cai G, Michigami T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, Mushiake S, Okada ... fraction was collected from the top of the gradient and assayed for alkaline phosphatase activity (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase ... (ordinate, unit per mL fraction) BSA (b, 68 kDa), alcohol dehydrogenase (a, 141 kDa) and catalase (c, 250 kDa) were loaded on to a separate gradient as molecular mass markers Not only the aggregate...
- 14
- 445
- 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin ... Pike et al (GAGs) [3] Glycosaminoglycans such as heparin, heparan sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases, ... Conard J, Brosstad F, Lie Larsen M, Samama M & Abildgaard U (1983) Molar antithrombin concentration in normal human plasma Haemostasis 13, 363– 368 Skinner R, Abrahams JP, Whisstock JC, Lesk AM,...
- 10
- 668
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... somewhat smaller on average than those in extracts from Artemia, and by way of comparison, small heat shock /a- crystallin proteins produced in transformed bacteria usually reside as oligomers similar...
- 10
- 495
- 0
Social Marketing: A Resource Guide from the Social Marketing National Excellence Collaborative doc
... for assessment, design and late market penetration Feedback from target audiences was anecdotal Gatekeepers and health care professionals for the most part approved and helped distribute information ... outline a social marketing approach aimed at changing behaviors among your target audience Facilitators will be available during this workshop to answer questions Each group should appoint a spokesperson ... These are the five foundations that support it They all need to be in place We can use the “P”s as a way to recognize and balance weaknesses in our programs (For example, you may have caring staff...
- 94
- 316
- 0
Báo cáo khoa học: Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx
... test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and national ethical guidelines Animal model of septic ... IL-1b) All animals were maintained and handled according to local and national ethical guidelines Statistical analysis Data are represented as means ± SD The significance of the results was assessed ... proinflammatory effects of fragments generated from extracellular matrix degradation by elastase are well documented For example, degradation products of elastin or heparan sulfate proteoglycan can...
- 12
- 499
- 0
Báo cáo khoa học: Discovery of a eugenol oxidase from Rhodococcus sp. strain RHA1 ppt
... bound Covalent flavinylation was accompanied by an increase in oxidase activity and formation of hydrogen peroxide This confirms a mechanism of autocatalytic covalent flavinylation in which a reduced ... dehydrogenase, 36 kDa; carbonic anhydrase, 29 kDa; soybean trypsin inhibitor, 20 kDa; a- lactalbumin, 14.2 kDa; aprotinin, 6.5 kDa) Lane 2a: protein-stained cell-free extract Lane 3a: protein-stained cell-free ... primers: forward, 5¢-CACCATATGACG CGAACCCTTCCCCCA-3¢ (NdeI site is underlined); and reverse, 5¢-CACAAGCTTCAGAGGTTTTGGCCACGG-3¢ (HindIII site is underlined) After amplification, the DNA was digested...
- 11
- 520
- 0
Báo cáo khóa học: Localization, purification and properties of a tetrathionate hydrolase from Acidithiobacillus caldus pot
... These data indicated that the fractionation procedure was satisfactory and that the tetrathionate hydrolase is a periplasmic enzyme Purification of the tetrathionate hydrolase from tetrathionate-grown ... hydrolase activity was located to the soluble fraction Further fractionation to the periplasmic, cytoplasmic, and membrane fractions revealed that tetrathionate hydrolase (96%) and acid phosphatase ... was a homodimer with a molecular mass of 103 kDa as determined with MALDI-TOF MS Except for tetrathionate hydrolase from A ferrooxidans strain Funis-2 [20] all other tetrahionate hydrolases have...
- 9
- 609
- 0
Báo cáo khoa học: Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath) ppt
... Actinobacteria Aquificae Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria ... Siphonosoma cumanense Protein Seq Data Anal 3, 141–147 Yano H, Satake K, Ueno Y & Tsugita A (1991) The amino acid sequence of the beta chain of hemerythrin from Lingula unguis Protein Seq Data Anal ... termophilum Aquifex aeolicus Magnetospirillum gryphiswaldense Burkholderia mallei Burkholderia pseudomallei Janthinobacterium sp J3 Ralstonia solanacearum Pseudomonas aeruginosa Pseudomonas resinovorans...
- 13
- 501
- 0
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx
... HOG pathway in S cerevisiae MAP kinase cascades typically composed of three tiers of protein kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling ... illustrated by an artificial example as well as by a simple real example extracted from the HOG (high osmolarity glycerol response) pathway for hyperosmolarity adaptation in budding yeast (Saccharomyces ... can be obtained by properly chosen n parameter perturbations All these approaches are based on parameter perturbation experiments which are, however, not always achievable in many practical cases...
- 10
- 375
- 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... A- 6-D45918: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N-acyl-D-amino acid amidohydrolase; A- 6-D45919: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N-acyl-D-Asparate amidohydrolase; A- 6-D50061: Alcaligenes ... N-D-AAase, was also produced in the Escherichia coli, purified and characterized MATERIALS AND METHODS Bacterial strains, plasmids and conditions Variovorax paradoxus Iso1 was isolated from an...
- 11
- 656
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng 9 tr 25