a of b in c for d to

30. This .................. for his behavior. a. amounts b. accounts c. arrives d. approaches b pot

30. This .................. for his behavior. a. amounts b. accounts c. arrives d. approaches b pot

... headache c chair d cheat b a < /b> none b stone c bone d alone a < /b> a because b clause c cause d aunt d a < /b> hungry b huge c rush d bus b a < /b> peace b reaper c reader d realize d a < /b> down b snow c crowd d ... d a < /b> pain b fountain c complain d explain b a < /b> large b stage c league d lounge c a < /b> cape b captain c capsule d capital a < /b> a boat b roar c roast d toast b a < /b> monkey b storey c money d survey d ... motion of < /b> bodies and the action of < /b> forces that change or cause motion dynamics a < /b> call b is called c is calling d called b 28 You shouldn't eat the processed food containing artificial a < /b> additions...

Ngày tải lên: 18/06/2014, 17:20

43 380 0
22. There is only a chair ............... leg was broken. a. whose b. which c. when d. that a 23. potx

22. There is only a chair ............... leg was broken. a. whose b. which c. when d. that a 23. potx

... loud c pour d mouse c a < /b> roar b coat c roast d toast a < /b> a sick b surely c search d send b a < /b> room b gloomy c poor d wood c a < /b> know b cow c tower d now a < /b> a doubt b count c bought d cloud c Find ... house a < /b> in / of < /b> b on / of < /b> c in / from d on / from c Test 37 Pronunciation a < /b> meat b heat c defeat d learn d a < /b> hard b bath c partner d hazard d a < /b> long b strong c obey d log c a < /b> cock b clock c slope ... a < /b> be torn up b be edited c be published d be revised c 38 B comes A < /b> and C in the English alphabet a < /b> between b among c for d with a < /b> 39 After lunch, Mary cleared the table a < /b> cleaned the table...

Ngày tải lên: 18/06/2014, 17:20

43 594 0
a. annoying b. arguing c. discussing d. shouting b 22. A good clock always keeps ...………. ppt

a. annoying b. arguing c. discussing d. shouting b 22. A good clock always keeps ...………. ppt

... c bere d mercer > c a < /b> gen b guard c gun d gate > a < /b> a obscure b obstacle c obtain d obstructive > b a < /b> studio b dual c dull d duvet > c a < /b> clear b tear c pear d rear > c a < /b> pub b rob c comb ... Pronunciation a < /b> valid b valiant c valley d valise > d a < /b> mechanics b mechanise c mechanism d mechanist > a < /b> a yacht b church c change d cheat > a < /b> a ginger b ingredient c dialogue d league > a < /b> a ... is adopted c that a < /b> drastic measure be adopted d a < /b> drastic measure to be adopted c 48 The fire spread through the building quickly but everybody a < /b> was able to escape b managed to escape c could...

Ngày tải lên: 18/06/2014, 17:20

43 721 0
Câu 21. Cho các chất : CH2ClCOOH (a); CH3COOH (b); C6H5OH(c), CO2(d); H2SO4(e). pot

Câu 21. Cho các chất : CH2ClCOOH (a); CH3COOH (b); C6H5OH(c), CO2(d); H2SO4(e). pot

... 0,44 gam C ng th c phân tử A < /b> C6 H6 C3 H6 C2 H4 D C4 H4 C u 26 D n khí H2S vào dung d ch ch a < /b> chất tan FeCl3, AlCl3, CuCl2, NH4Cl, thu kết t a < /b> X X ch a < /b> A CuS B FeS, CuS C CuS, S D FeS, Al2S3, CuS C u ... kg C u 30 Để thu butanol-2, ta hiđrat hố hiđrocacbon c c ng th c cấu tạo: A < /b> CH2 = C( CH3)2 (3) B C (1) (2) C CH3 – CH = CH – CH3 (2) D CH2 = CH – CH2 – CH3 (1) C u 31 Cho chất: CH3COOC2H5 (a)< /b> ; ... suất cao, nhiệt độ không cao h a < /b> lỏng để tách NH3 khỏi hỗn hợp C u 38 Trong số chất: NaCl, Ca(OH)2, Na2CO3, HCl, chất làm mềm nư c cứng tạm thời A < /b> Na2CO3 HCl B NaCl Na2CO3 C NaCl HCl D Na2CO3 Ca(OH)2...

Ngày tải lên: 01/08/2014, 22:21

7 965 1
The Case for Controlled-Atmosphere Killing of Poultry in Transport Containers Prior to Shackling as a Humane Alternative to Electrical Stunning doc

The Case for Controlled-Atmosphere Killing of Poultry in Transport Containers Prior to Shackling as a Humane Alternative to Electrical Stunning doc

... impossible to ensure that every bird is dead, let alone unconscious, before proceeding to the scald tank Scalding Birds are dipped into the scald tank, which contains scalding hot water, to facilitate ... can be gained per year Reducing the number of < /b> birds who are dead on arrival, which can be achieved by eliminating dumping and other areas of < /b> rough handling that are inherent in the electrical ... of < /b> avoidance behavior—birds are conveyed toward an automated spinning blade, commonly referred to as the “killing machine,” which is designed to cut their necks Some conscious birds are able to...

Ngày tải lên: 31/03/2014, 08:20

16 504 0
Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG pK9 Pol I EB (1816) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... GTCTCCACCGACCGCGTATCGCCCCTCCTCACCCCCCCCCCCCCCCGGGTTACCTGGGGCGACCAGAAAGCCCTGGGGGCNGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTT pK9 Pol I EB (1568) GTCTCCACCGACCG-GTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTG ... TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT pK9 Pol I EB (1944) TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT...

Ngày tải lên: 18/06/2014, 18:20

12 567 0
Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG pK9 Pol I EB (1816) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... GTCTCCACCGACCGCGTATCGCCCCTCCTCACCCCCCCCCCCCCCCGGGTTACCTGGGGCGACCAGAAAGCCCTGGGGGCNGGGGGCTCCGTGGGGTGGGGGTGGGGGGGCGCCGTGGGGCAGGTTTT pK9 Pol I EB (1568) GTCTCCACCGACCG-GTATCGCCCCTCCTCCCCTCCCCCCCCCCCCCCGTTCCCTGGGTCGACCAGATAGCCCTG ... TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT pK9 Pol I EB (1944) TCCCTGTCCTCGCTCGCTGGAGCCTGAGCCGTCCGCCTGGGCCTGCGCGCCGGCTCTCGTGCTGGACTCCAGGTGGCCCGGGTCGCGGTGTCGCCCTCCGGTCTCCGGCACCCGAGGGAGGGCGGTGT...

Ngày tải lên: 20/06/2014, 01:20

12 627 0
Multi-criteria Evaluation of Wastewater Treatment Scenarios for Small Towns in Developing Countries - Case Study of Toan Thang Town in Vietnam

Multi-criteria Evaluation of Wastewater Treatment Scenarios for Small Towns in Developing Countries - Case Study of Toan Thang Town in Vietnam

... using a < /b> series of < /b> waste stabilization ponds including anaerobic ponds, facultative ponds and maturation ponds to reduce the organic and microbial pollutants to an acceptable level before discharging ... E., Corvetto J and Tobias S (2002) Improving Sanitation in Small Towns In Latin America and the Caribbean - Practical Methodology for Designing a < /b> Sustainable Sanitation Plan, Office of < /b> Health, Infectious ... into water bodies Sequencing batch reactor (SBR); then effluent will be discharged into irrigation canals and/or water bodies UASB + Activated Sludge/Trickling Filter/Rotating Biological Contactor;...

Ngày tải lên: 05/09/2013, 10:15

23 780 0
Báo cáo khoa học: Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase Importance of a V-shaped dimeric structure for binding to protein substrate docx

Báo cáo khoa học: Engineering of monomeric FK506-binding protein 22 with peptidyl prolyl cis-trans isomerase Importance of a V-shaped dimeric structure for binding to protein substrate docx

... (Reduced α-lactalbumin) (μM) Fig Binding of < /b> reduced a-< /b> lactalbumin to NNC-FKBP22 and to SIB1 FKBP22 (A)< /b> Sensorgrams from Biacore X showing the binding of < /b> reduced a-< /b> lactalbumin (100 lM) to immobilized ... the binding affinities of < /b> NNC-FKBP22 and WT to reduced a-< /b> lactalbumin were analyzed using surface plasmon resonance (Biacore) Reduced a-< /b> lactalbumin was injected onto the sensor chip, on which NNC-FKBP22 ... was used as a < /b> template The sequences of < /b> the PCR primers used are as follows: 5¢-AGAGAGAATTCATATGTCAGATT TGTTCAG-3¢ for primer 1; 5¢-TTCCATACCACCACCT GCAACTTGAAGCTC-3¢ for primer 2; 5¢-GTTGCAGGT...

Ngày tải lên: 30/03/2014, 01:20

11 355 0
b. Was c. Had d. Have b 22. "Did Susan use to be your next-door neighbor?" "Yes, but I potx

b. Was c. Had d. Have b 22. "Did Susan use to be your next-door neighbor?" "Yes, but I potx

... request) a < /b> Mary said to John to book her seat in advance b Mary told John book her seat in advance c Mary told John that he booked her seat in advance d Mary told John to book her seat in advance d ... c carefully d careless b Test 46 Pronunciation a < /b> step b clergy c bench d lend b a < /b> football b thanks c stall d wall b a < /b> cattle b castle c kettle d subtle b a < /b> standard b farmer c start d farther ... learned c learning d learn c Test 50 Pronunciation a < /b> pleasure b sit c say d best > a < /b> a bare b dare c fare d barred > d a < /b> birth b with c both d seventh > b a < /b> think b ink c banner d sing > c...

Ngày tải lên: 18/06/2014, 17:20

43 756 1
báo cáo hóa học: " Adalimumab improves health-related quality of life in patients with moderate to severe plaque psoriasis compared with the United States general population norms: Results from a randomized, controlled Phase III study" pdf

báo cáo hóa học: " Adalimumab improves health-related quality of life in patients with moderate to severe plaque psoriasis compared with the United States general population norms: Results from a randomized, controlled Phase III study" pdf

... Psoriasis symptomatology, including pain and itching, combined with concerns about the appearance of < /b> one's skin can substantially affect a < /b> patient's psychological well-being and can result in emotional ... NH, and MKW designed and interpreted the analysis of < /b> health-related quality of < /b> life data AM and SF assisted Abbott Laboratories with the original Phase III study design and acquisition of < /b> data All ... comparable [25] Statistical analyses Descriptive statistics Descriptive statistics were reported for demographic and clinical characteristics of < /b> the REVEAL sample Means and standard deviations...

Ngày tải lên: 18/06/2014, 19:20

8 518 0
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc

Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc

... drug candidates are limited by insufficient efficacy and unfavorable pharmacokinetics MAbs have increasingly gained favor in large part because of < /b> the development of < /b> chimeric, humanized, and human ... Progenics Pharmaceuticals Tanox, Inc., Biogen, Inc (Massachusetts) OraSure Technologies, Inc CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune ... produces limited immunity at best In fact, an inactivated RSV vaccine paradoxically resulted in more severe disease instead of < /b> protection [7] The most successful approach to date has been Biochemical...

Ngày tải lên: 18/06/2014, 22:20

6 568 0
báo cáo hóa học:" Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" pdf

báo cáo hóa học:" Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" pdf

... drug candidates are limited by insufficient efficacy and unfavorable pharmacokinetics MAbs have increasingly gained favor in large part because of < /b> the development of < /b> chimeric, humanized, and human ... Progenics Pharmaceuticals Tanox, Inc., Biogen, Inc (Massachusetts) OraSure Technologies, Inc CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune ... produces limited immunity at best In fact, an inactivated RSV vaccine paradoxically resulted in more severe disease instead of < /b> protection [7] The most successful approach to date has been Biochemical...

Ngày tải lên: 20/06/2014, 04:20

6 561 0
Báo cáo khoa học: "Growth and development of individual Douglas-fir in stands for applications to simulation in silviculture" potx

Báo cáo khoa học: "Growth and development of individual Douglas-fir in stands for applications to simulation in silviculture" potx

... general applicability and immediate availability This kind of < /b> information is best found at the level of < /b> individual tree growth An advantage of < /b> this approach is that large stand data are not necessarily ... level, and dying branches below The distance (L) of < /b> each node to the stem apex was measured, and discs were cut at about equal spacings An average of < /b> 10 discs per tree was collected; the biggest ... detailed approach is possible, by not con- Staebler (1951) was to relate individual tree in this case, for each tree in a < /b> stand local conditions are only accounted for statistically, by comparison between...

Ngày tải lên: 08/08/2014, 23:22

16 369 0
Báo cáo y học: "Determining a low disease activity threshold for decision to maintain disease-modifying antirheumatic drug treatment unchanged in rheumatoid arthritis patients" docx

Báo cáo y học: "Determining a low disease activity threshold for decision to maintain disease-modifying antirheumatic drug treatment unchanged in rheumatoid arthritis patients" docx

... recommendations for clinicians to use the DAS28 in clinical practice in the area of < /b> uncertainty (DAS28 of < /b> to 3.2), in order to guide the decision to maintain unchanged or to not maintain a < /b> DMARD ... possibility [1-3] In clinical practice, active disease means that clinicians will increase the treatment to obtain remission; but that also means that clinicians can stop, add to or increase treatments ... characteristics of < /b> age, sex, and year of < /b> diploma, but not of < /b> type of < /b> practice Finally, according to these results, panelists concluded that in clinical practice there is no need to change DMARD...

Ngày tải lên: 09/08/2014, 14:22

8 354 0
báo cáo khoa học: " Functional analysis of B and C class floral organ genes in spinach demonstrates their role in sexual dimorphism" pdf

báo cáo khoa học: " Functional analysis of B and C class floral organ genes in spinach demonstrates their role in sexual dimorphism" pdf

... were dehydrated in a < /b> graded ethanol series, cleared in HistoClear© (National Diagnostics, Atlanta, GA, USA), and embedded in Paraplast Plus© (Fisher Chemicals, Fairlawn, NJ, USA) paraffin before ... previously argued, the B class genes are attractive candidates as regulators of < /b> sex determination in spinach It has been shown that B class genes in Arabidopsis are direct regulatory targets of < /b> gibberellic ... start codon) -708 (GCAAATTAGG) and 384 (CCAAATTGC) A < /b> third potential CArG box (TCATATTTGG) is located in the second intron at position 785 Similarly LEAFY binding sites have been determined in intronic...

Ngày tải lên: 12/08/2014, 03:21

14 328 0
Báo cáo y học: "Canakinumab relieves symptoms of acute flares and improves health-related quality of life in patients with difficult-to-treat Gouty Arthritis by suppressing inflammation: results of a randomized, dose-ranging study" ppt

Báo cáo y học: "Canakinumab relieves symptoms of acute flares and improves health-related quality of life in patients with difficult-to-treat Gouty Arthritis by suppressing inflammation: results of a randomized, dose-ranging study" ppt

... assessed for anti-canakinumab antibodies at baseline and at eight weeks post-dose using a < /b> validated Biacore® binding assay (Biacore International AB, Uppsala, Sweden) [25] Pain intensity scores (according ... contraindicated for NSAIDs and/or colchicine; body mass index (BMI) ≤40 kg/m2 Unresponsiveness and intolerance to NSAIDs and/or colchicine and contraindication for NSAIDs and/or colchicine were based on ... reported here for canakinumab are in agreement with accumulating evidence suggesting that IL- 1b, in addition to mediating inflammation, can stimulate pain directly by activating nociceptors (pain...

Ngày tải lên: 12/08/2014, 15:22

13 419 0
Báo cáo sinh học: " A short-term divergent selection for resistance to Teladorsagia circumcincta in Romanov sheep using natural or artificial challenge" pptx

Báo cáo sinh học: " A short-term divergent selection for resistance to Teladorsagia circumcincta in Romanov sheep using natural or artificial challenge" pptx

... stay in the central farm Artificial challenges seem to be preferable to natural infection for assessing resistance in a < /b> breeding scheme, because the duration and impact of < /b> infection can be minimised ... analysed by a < /b> factor combining sex and reproductive status (ram lambs, dry ewes or lambing ewes) In addition to the lamb’s sex, the fixed date of < /b> measurement effects according to the type of < /b> data under ... theoretical point of < /b> view, because it indicates that parasitological studies on the mechanisms of < /b> host resistance could be done using a < /b> very simple and standardised method (artificial infection) for animal...

Ngày tải lên: 14/08/2014, 13:22

26 232 0
w