a novel computing approach in modeling water flows

... the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work (based on site working ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... monthly, farmers made saving and sharing skills and experiences in farming among themselves, especially to manage and use their own finance effectively Besides learning more about women farming activities,...

Ngày tải lên: 16/01/2014, 21:20

... A (62 mg) was separated by centrifugation and the water- soluble part was repeatedly chromatographed on a P-4 column, giving a major (OS-1, 8.5 mg) and a minor (OS-2, 3.7 mg) OS-containing fraction ... (Finnigan-MAT; San Jose, CA, USA) in the positive ion mode The samples were dissolved in methanol /water (7 : 3) containing mM NaOAc to a concentration of about mgÆmL)1, and were injected into a ... Methylation analysis was performed as described previously [16] The relative proportions of the various alditol acetates and partially methylated alditol acetates obtained in sugar- and methylation analyses...

Ngày tải lên: 08/03/2014, 02:21

... The C-terminal amino acid was amidated in all three chrysophsins, similarly to those in marine animals, such as solitary ascidians (styelin D) [31] and hybrid striped bass (Morone saxatilis x ... equal against B subtilis and E coli (Table 2), bactericidal activity against fish and crustacean pathogens was investigated with the synthetic chrysophsins (Table 3) All three were active against ... KCl, and 43–48 0.4–1 M KCl CA, USA) by analyzing the data calibrated with 10 pmol phenylthiohydantoin amino-acid standards Tricine/SDS/PAGE The molecular mass of the sample was estimated by Tricine/...

Ngày tải lên: 23/03/2014, 20:22

... nippona The same amount of sample was applied to each lane Lane M, molecular mass standards; lane A, CBB staining; lane B, Stains-all staining; lane C, negative staining; lane D, Methyl green staining ... buffer containing 2-mercaptoethanol after boiling, and subsequent staining procedures with negative staining, Stains-all and Methyl green visualized an exclusive band of approximately 52 kDa, which ... preferably over Glu, and a single Cys residue was located at its center A search of the nonredundant GenBank CDS database using blast (protein–protein blast and Search for short, nearly exact matches)...

Ngày tải lên: 30/03/2014, 04:20

... this article as: Rahma et al.: A pilot clinical trial testing mutant von Hippel-Lindau peptide as a novel immune therapy in metastatic Renal Cell Carcinoma Journal of Translational Medicine 2010 ... by helping in the manuscript drafting Drs Samara and Abdalla are postdoctoral fellows at the National Cancer Institute Author details Vaccine Branch, NCI, NIH, Bethesda, MD, USA 2Medical Oncology ... RRIHSYRGDLWLFRDA MEAGRPRPCCAR RLALQRCRDTRWA Rahma et al Journal of Translational Medicine 2010, 8:8 http://www.translational-medicine.com/content/8/1/8 Page of Table VHL mutations and HLA types in vaccinated...

Ngày tải lên: 18/06/2014, 16:20

... expanding a given image based on an interpolator which is trained in advance with training data by using sparse Bayesian estimation [12] This method is not based on PCA and KPCA, but calculates ... local approaches, all of the training local patches are not necessarily in the same class, and their eigenspace tends not to be obtained accurately In addition, Kanemura et al proposed a framework ... Adaptive example-based super-resolution using Kernel PCA with a novel classification approach Takahiro Ogawa∗1 and Miki Haseyama1 Graduate School of Information Science and Technology, Hokkaido...

Ngày tải lên: 18/06/2014, 22:20

... expanding a given image based on an interpolator which is trained in advance with training data by using sparse Bayesian estimation [12] This method is not based on PCA and KPCA, but calculates ... local approaches, all of the training local patches are not necessarily in the same class, and their eigenspace tends not to be obtained accurately In addition, Kanemura et al proposed a framework ... Adaptive example-based super-resolution using Kernel PCA with a novel classification approach Takahiro Ogawa∗1 and Miki Haseyama1 Graduate School of Information Science and Technology, Hokkaido...

Ngày tải lên: 20/06/2014, 04:20

... between layers, and therefore, has attracted a lot of attentions in recent years Cross-layer optimization methods can be categorized into application adaptation, application-centric adaptation, ... action can be taken Sensing information can be a consideration for QoS requirements especially in multimedia application as it can assist C-UWB to dynamically allocate appropriate resources in ... middle layer centric approach, middleware-based adaptation, and autonomous adaptation [3] as shown in Figure Additionally, [9] introduced cognitive engine (CE) architecture that removes the distance...

Ngày tải lên: 21/06/2014, 11:20

... became busy entertaining Aunt Polly in the kitchen and forgot all about punishing me In the meantime, I apologized to Jill and applied some ointment on her arm Before long, we were on speaking ... conversation while waiting for our cabs My cousin and I began to get worried when we had waited for quite some time and no cab had passed by Finally a cab came We waved good-bye to the girl because she ... uncle at the airport We decided to catch a cab there At the taxi-stand, I saw the girl whom I met in the washroom This time, she was ahead of me in the queue We started a friendly conversation...

Ngày tải lên: 22/07/2014, 03:21

... (5'TG AAAACTGAACAAAAGAC3') together with one of the reverse primers S1OLIGO3' (CTAAACTAACATAAGGG C3') or degenerate3'-2 (5'CCATAAGTAACATAAGGG CAA3') [14,16] The RT reaction for synthesis of cDNA ... (Promega, USA) and transformed into JM 109 competent cells (Promega, USA) The cells carrying recombinant plasmids were selected on Luria-Bertani agar plates containing ampicillin, X-gal and IPTG, and ... - Arkansas KM91‡ KM91 KM91 KM91 KM91 Variant KM91 Variant Variant Variant Variant GenBank accession numbers AY790368 AY790359 AY790360 AY790358 AY790362 AY790361 AY790366 AY790365 AY790363 AY790364...

Ngày tải lên: 07/08/2014, 20:23

... of a coin Science 2005, 307:1904-1909 Aarnio M, Sankila R, Pukkala E, Salovaara R, Aaltonen LA, de la Chapelle A, Peltomäki P, Mecklin JP, Järvinen HJ: Cancer risk in mutation carriers of DNA-mismatch-repair ... boxes indicate a diagnosis of colon cancer, and crosshatched boxes indicate cancer of non-colorectal origin A diagonal strikethrough indicates a deceased individual Unconfirmed diagnoses of individuals ... adjuvant chemotherapy consisting of cisplatin and taxol combined with radiotherapy, and is disease-free at the time of publication A comprehensive family history was taken and a formal pedigree was...

Ngày tải lên: 09/08/2014, 04:21

... (f) An area of an OA synovium demonstrates a lining layer completely devoid of c19orf10 staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical ... synovial lining layer and perivascular regions of OA (paraffin section) tissue (c) An area demonstrating a thin lining layer and perivascular region populated with c19orf10-positive cells Note that ... were dehydrated in ascending graded ethanol and infiltrated and embedded in low-melting paraffin at 56°C in a heated oven The tissue-paraffin mold was solidified on a cold plate to form a block...

Ngày tải lên: 09/08/2014, 10:20

... forward, 5’-AGGCAGACAGGCTCTCAAAC-3’; reverse, 5’-GGCAGAATTAGATGCCATTG-3’ Real-time quantitative PCR The amount of nuclear DNA and mtDNA in the skeletal muscle of the patient and four age- and ... Chalmers RM, Oldfors A, Rautakorpi I, Peltonen L, Majamaa K, Somer H, Suomalainen A: Parkinsonism, premature menopause, and mitochondrial DNA polymerase gamma mutations: clinical and molecular ... Suomalainen A, Majander A, Wallin M, Setala K, Kontula K, Leinonen H, Salmi T, Paetau A, Haltia M, Valanne L, Lonnqvist J, Peltonen L, Somer H: Autosomal dominant progressive external ophthalmoplegia...

Ngày tải lên: 09/08/2014, 23:20

... Foundation and International Society of Heart and Lung Transplantation (AS) Lists of abbreviations AFAP: actin filament associated protein; AFAP1L2: actin filament associated protein 1-like 2; PH domain: ... contains a coiled-coil domain A common feature of XB130 (818aa) and AFAP (730aa) is the presence of potential SH2, SH3-binding sites and two PH domains A coiled-coil domain of XB130 shares partial ... expressed in a subset of colorectal carcinomas These findings indicate that XB130 has an important role in the regulation of tyrosine kinase-mediated signaling Roles of XB130 in cell cycle and survival...

Ngày tải lên: 10/08/2014, 09:22

... Functionalized europium oxide nanoparticles used as a fluorescent label in an immunoassay for atrazine Anal Chem 2003, 75:5282-5286 Patra CR, Alexandra G, Patra S, Jacob DS, Gedanken A, Landau A, ... Williams CS, Boudreau R, Le Gros MA, Larabell CA, Alivisatos PA: Biological applications of colloidal nanocrystals Nanotechnology 2003, 14:R15-R27 Jain KK: Nanotechnology in clinical laboratory ... Scattering and Absorption of anti-EGFR Antibody Conjugated Gold Nanoparticles in Cancer Diagnostics: Applications in Oral Cancer Nano Lett 2005, 5:829-834 Dubertret B, Calame M, Libchaber A: Single-mismatch...

Ngày tải lên: 11/08/2014, 00:22

... in HBsAg had been reported in following studies, they included 2-aa insertion between aa122 and aa123 [15,16], 3-aa insertion between aa123 and aa124 [16], 1-aa insertion between aa121 and aa122 ... occurred in clone13 at aa156 (TGG®TAG), aa191 (TGG®TGA) and aa196(TGG®TGA), in clone14 at aa206 (TAC®TAG) and in clone15 at aa223 (TGG®TGA), respectively Discussion Carman proposed to separate MHR into ... aa122 [20], 3-aa insertion between aa118 and aa119 [18], 2-aa deletion from aa110 to aa111 [17], 4-aa deletion from aa119 to aa122 [17], 3-aa deletion from aa113 to aa115 [21] Those insertion/deletion...

Ngày tải lên: 12/08/2014, 04:20

... performed in a blinded fashion without knowledge of the clinical status of the patient Statistical analysis Continuous baseline data are expressed as the means ± standard deviation Categorical variables ... mortality in our sample Septic shock and copeptin were colinear variables, and competed in the multivariate analysis, since they express the same phenomenon, as clinical and laboratorial variables, ... well as Table Odds ratios for mortality in 71 ventilator-associated pneumonia patients on day 4: univariable and multivariable logistic regression analysis Parameter Univariable analysis Multivariable...

Ngày tải lên: 13/08/2014, 10:20

... Commerce-Tourism after applying a discourse-based approach in teaching English reading skill - To investigate what extent the application of a discourse-based approach helps students at Thanh Hoa Vocational ... social situation British discourse analysis was mainly influenced by M .A. K Halliday‘s functional approach to language Halliday‘s framework emphasized the social function of language and the thematic ... (2001), action research is known by many other names, including participatory research, collaborative inquiry, emancipatory research, action learning, and contextual action research, but all are variations...

Ngày tải lên: 28/03/2015, 09:26

... Component analysis (PCA), linear and quadratic discriminant analysis (LDA and QDA) and analysis of independence relations in the context of graphical models all need to Chapter 1: Introduction estimate ... Khare and Rajaratnam (2009) Due to the limitation of Bayesian theory, Khare and Rajaratnam constructed a family of Wishart distributions as the parameter space for covariance graphical model, instead ... indicates a marginal independence Covariance matrix estimation is a common statistical problem that arises in many scientific applications, such as financial risk assessment and longitudinal study...

Ngày tải lên: 10/09/2015, 15:53

... presented and discuss in Chapter Section Introduction Figure 1.3 a T7 promoter TAATACGACTCACTATAGGGAGA SP6 promoter ATTTAGGTGACACTATAGAAGNG T3 promoter AATTAACCCTCACTAAAGGGAGA b Figure 1.3 Paradigm ... fifth cause of death among all cancers The annual incidence is increasing at a rate of 0.5% globally, and at 4% in Asia, making the estimated new cases at 1.5 million in year 2010 (1) At present, ... 2000;165(2):1153-9 52 Ohminami H, Yasukawa M, Kaneko S, Yakushijin Y, Abe Y, Kasahara Y, et al Fas-independent and nonapoptotic cytotoxicity mediated by a human CD4(+) Tcell clone directed against an acute myelogenous...

Ngày tải lên: 12/09/2015, 09:59