a novel approach to model biology and disease

Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx

Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx

... liver parenchyma Br J Surg 1999, 86:784-788 Kokudo N, Tada K, Seki M, Ohta H, Azekura K, Ueno M, Ohta K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: ... Preoperative portal vein embolization for extension of hepatectomy indications Hepatology 1996, 24:1386-1391 Imamura H, Shimada R, Kubota M, Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: ... M, Miyagawa S, Kakazu T: Radical operation after portal embolization for tumor of hilar bile duct J Am Coll Surg 1994, 178:480-486 Kawasaki S, Makuuchi M, Kakazu T, Miyagawa S, Takayama T, Kosuge...

Ngày tải lên: 09/08/2014, 04:21

7 384 0
Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx

Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx

... necessary for B-cell activation and contributes to a prolongation of Bcell antigen receptor signaling Thus, CR2 plays an important role in B-cell activation and combines the innate and adaptive arms ... regulated This regulation is mediated by proteins such as cell surface-like membrane cofactor protein (MCP), decay accelerating factor (DAF) and protectin (CD59), and the soluble factor H(fH) that ... protection against invading pathogens but also interacts with the adaptive immune system to optimize the pathogen-specific humoral and cellular defense cascade in the body, especially for viral pathogens...

Ngày tải lên: 12/08/2014, 04:21

4 287 0
Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc

Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc

... necessary for B-cell activation and contributes to a prolongation of Bcell antigen receptor signaling Thus, CR2 plays an important role in B-cell activation and combines the innate and adaptive arms ... regulated This regulation is mediated by proteins such as cell surface-like membrane cofactor protein (MCP), decay accelerating factor (DAF) and protectin (CD59), and the soluble factor H(fH) that ... protection against invading pathogens but also interacts with the adaptive immune system to optimize the pathogen-specific humoral and cellular defense cascade in the body, especially for viral pathogens...

Ngày tải lên: 12/08/2014, 04:22

4 272 0
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf

Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf

... media as applied to groundwater flow modelling [15,16] Following such an approach, geologic materials -and in our case the SC- may Page of 25 Marquez-Lago et al Theoretical Biology and Medical Modelling ... through appendages such as hair follicles and sweat glands Although the relative importance of each is still not clear, there is a general consensus that the intercellular pathway plays a major ... resistance to chemical and physical attacks, and in their normally dehydrated state also provide obstacles against water loss through the skin A diffusing molecule has to cross multiple bilayers...

Ngày tải lên: 13/08/2014, 16:20

25 373 0
Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications

Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications

... clinical trial, assigned according to the randomization list The appropriate package was handed to the particular participant Statistical data analysis and power calculation Statistical data analysis ... ATA CCG 21 nt Lacto-R2 CGT CCA TTG TGG TAG ATT CCC T 22 nt Lacto-S CTG AGA CAC GGC CCA WAC TCC TAC GG 26 nt F_reut_IS ACC GAG AAC AAC GCG TTA TTT 21 nt R_reut_IS CAT AAC TTA ACC TAA ACA ATC AAA ... CAC GAG CTG ACG ACA RCC ATG CA 23 nt tuf-F TGG TCA GGT ACT GGC TAA GC 20 nt tuf-R TCT TTG GAC AGA ATG TAC ACT TCA 24 nt tuf-S CCA TCA AGC CGC ACA CCA AGT TCG 24 nt Lacto-F2 TGG AAA CAG ATG CTA...

Ngày tải lên: 19/11/2015, 16:47

105 331 0
Listening to Patients A Phenomenological Approach to Nursing Research and Practice

Listening to Patients A Phenomenological Approach to Nursing Research and Practice

... heritage are valued We are Christians and Jews, Appalachians and Easterners, Black and White, men and women, young and old, graduate students and faculty All contribute their own unique and useful ... want to sit in a wheelchair okay So my husband pushed me down to therapy the first day And this big man approached me and said Tm here to help you I'll teach you to walk.' He said, 'You'll stand ... the American Nurses Association, the American Psychological Association, and Sigma Theta Tau International She is a board member of the International Council on Women's Health Issues and a charter...

Ngày tải lên: 16/10/2013, 11:15

309 399 0
Aaron r  bradley   programming for engineers  a foundational approach to learning c and matlab

Aaron r bradley programming for engineers a foundational approach to learning c and matlab

... 1121-1134, 1999 The second addresses cause -and- effect in cheating and performance: David J Palazzo, Young-Jin Lee, Rasil Warnakulasooriya, and David E Pritchard, Patterns, Correlates, and Reduction of Homework ... why the addresses are the particular values that they are later Each cell is annotated with its associated variable and the type of that variable The type indicates how to interpret the data The ... memory is to initialize variables at declaration: { int a = , b = 0; a = b; } In practice it is not always possible to find reasonable values to which to initialize variables, and one can still...

Ngày tải lên: 19/03/2014, 14:05

250 656 0
Báo cáo khoa học: "A Novel Approach to Semantic Indexing Based on Concept" ppt

Báo cáo khoa học: "A Novel Approach to Semantic Indexing Based on Concept" ppt

... method hardly discerns the subtle semantic importance of each texts, for example, Text1 and Text2 have the same rank Length normalization(LN) and standard TF discern each texts but fail to rank correctly ... chain was represented as a concept vector in concept vector space, and the overall text vector was made up of those concept vectors The semantic importance of concepts and words was normalized according ... specic topic relevant to exercise, diet, holiday blues,yoga, and weight control Most texts are related to a general topic, exercise Each subject was presented with ve short texts and asked to nd...

Ngày tải lên: 23/03/2014, 19:20

6 349 0
MDA: A Formal Approach to Game Design and Game Research ppt

MDA: A Formal Approach to Game Design and Game Research ppt

... formal, iterative approach to design and tuning It allows us to reason explicitly about particular design goals, and to anticipate how changes will impact each aspect of the framework and the resulting ... Talking about games and play is hard because the vocabulary we use is relatively limited In describing the aesthetics of a game, we want to move away from words like “fun” and “gameplay” towards ... a more directed vocabulary This includes but is not limited to the taxonomy listed here: Sensation Game as sense-pleasure Fantasy Game as make-believe Narrative Game as drama Challenge Game as...

Ngày tải lên: 30/03/2014, 16:20

5 630 0
Báo cáo khoa học: "A Hybrid Approach to Word Segmentation and POS Tagging" doc

Báo cáo khoa học: "A Hybrid Approach to Word Segmentation and POS Tagging" doc

... segmentation and POS tagging They compared several approaches, and showed that character-based approaches had higher accuracy than word-based approaches, and that conducting word segmentation and POS tagging ... corpora showed that the hybrid method had high accuracy in Chinese and Japanese 220 References Taku Kudo, Kaoru Yamamoto, and Yuji Matsumoto 2004 Applying Conditional Random Fields to Japanese ... corpora, and the rest were Japanese (J) corpora, and they were split into training and test data The dictionary distributed with JUMAN version 3.61 (Kurohashi and Nagao, 1998) was used as a word...

Ngày tải lên: 31/03/2014, 01:20

4 309 0
wiley - project management - a systems approach to planning, scheduling, and controlling (2001)

wiley - project management - a systems approach to planning, scheduling, and controlling (2001)

... escalation factors for salaries and raw materials, increased union demands, pressure from stockholders, and the possibility of long-term, high inflation accompanied by a mild recession and a lack ... only place he can go is to the line manager because additional re1 Here we are assuming that the line manager and project manager are not the same individual Page sources are almost always required ... customer's organization, whether an internal or external organization Organizational restraints have a tendency to develop into organizational conflict, often requiring that top management take an active...

Ngày tải lên: 16/04/2014, 11:11

1,4K 413 0
Báo cáo hóa học: " Research Article A Novel Approach to Detect Network Attacks Using G-HMM-Based Temporal Relations between Internet Protocol Packets" pot

Báo cáo hóa học: " Research Article A Novel Approach to Detect Network Attacks Using G-HMM-Based Temporal Relations between Internet Protocol Packets" pot

... normal behavior model and test dataset Then the combined dataset with normal and abnormal is tested SVM has a variety of kernel functions and their parameters, and we had to decide a regularization ... revised paper includes whole new Hidden Markov Model- based approach and the updated performance analysis, and overall parts like abstract, introduction, and conclusion are rewritten, and the main approach ... learning dataset with above-described dataset This dataset had 100,000 normal packets and 1,000 to 1,500 abnormal packets for training and evaluating each In the case of unsupervised learning algorithms...

Ngày tải lên: 21/06/2014, 05:20

14 500 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

... yield a convex optimization problem 3.2.1 Passband Narrow-band low-pass filters usually not exhibit a distinctive passband In order to obtain a narrowband low-pass filters it is sufficient to ask for ... passband and the transition bands As the objective function to be minimised we adopt a particular representation of the group delay [20], while the stopband magnitude specifications of the prototype ... the tolerance mask is not continuous and increases and diminishes stepwise Figure 2(b) depicts the group delay both in passband and transition band The group delay in the passband, which EURASIP...

Ngày tải lên: 21/06/2014, 19:20

13 624 0
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx

Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx

... , Ttotal − Tmin RA = Alimit , Atotal RS = Slimit Stotal (8) The totalised values for area Atotal , code size Stotal , and execution time Ttotal are simply built by the sum of the maximum gate ... l n k g m ALAP stalap (b) Figure 9: Two different start times for process (b) according to ASAP and ALAP schedule sequential device It has to be stated that Tmin and Ttotal are lower and upper ... modification was mandatory for the comparison to the partitioning techniques of Wiangtong et al [9] and Kalavade and Lee [8] To the best of our knowledge, Wiangtong et al [9] were the first group to...

Ngày tải lên: 22/06/2014, 06:20

13 310 0
embedded computing a vliw approach to architecture compilers and tools

embedded computing a vliw approach to architecture compilers and tools

... experimental use It includes a number of simulators, and its tools allow hardware reconfiguration and both manual and automated design-space exploration Code, documentation, and samples can be downloaded ... Non-cost and Genuine ! To my wife Elizabeth, our children David and Dora, and my parents, Harry and the late Susan Fisher And to my friend and mentor, Martin Davis Josh Fisher To the memory of my late ... adapted from IBM Corporation and ARM Ltd Figure 6.8 courtesy of Altera Corporation Altera is a trademark and service mark of Altera Corporation in the United States and other countries Altera...

Ngày tải lên: 03/07/2014, 16:08

709 1,2K 1
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular cartilage and synovial fluids of patients with rheumatoid arthritis Clin Rheumatol ... MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and OA [2-4]...

Ngày tải lên: 09/08/2014, 08:22

10 495 0
Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx

Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx

... serosanguinous fluid was aspirated (Figure 3) Dramatic pain relief was noted after aspiration An elastic stocking was applied to his left calf area after aspiration and follow-up two weeks later ... muscle Am J Sports Med 1977, 5:191-193 Takebayashi S, Takasawa H, Banzai Y, Miki H, Sasaki R, Itoh Y, Matsubara S: Sonographic findings in muscle strain injury: clinical and MR imaging correlation ... machine and S12 5–12 MHz real-time linear–array transducer (Philips Medical Systems) were used to examine the patient After careful examination, bilateral symmetrical sonographic findings of the calf...

Ngày tải lên: 11/08/2014, 17:21

4 316 0
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps

Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps

... TCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TAGCCCACGACAGCCAAATAATAATGAATCATTTCATAAATAATGGGTTTAGGGGCTTATCGGGA ... GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG ... musculus; Pt, Pan troglotydes; Rn, Rattus norvegicus scl 1.1 (b) (a) TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGCGGA TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG...

Ngày tải lên: 14/08/2014, 16:20

18 389 0
A markovian approach to the analysis and optimization of a portfolio of credit card accounts

A markovian approach to the analysis and optimization of a portfolio of credit card accounts

... demand, have no alternative but to rationalize and to automate their decision-making processes instead of using the classic judgemental analysis Today, credit card institutions deal with substantial ... interactive and automated taped phone message with mild level of severity interactive and automated taped phone message with moderate level of severity interactive and automated taped phone message ... Owing to the difficulty of obtaining confidential data, a simulation approach is favored To that end, an approximate dynamic programming approach is proposed to 1.4 Thesis Overview model the cardholders’...

Ngày tải lên: 16/09/2015, 14:04

184 498 0
w