a novel approach to data analysis
A novel approach to monitoring the efficacy of anti-tumor treatments in animal models: Combining functional MRI and texture analysis
... data, and writing manuscript Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request Authors’ ... the anti-angiogenic activity of bevacizumab compared with that of paclitaxel To ensure the accuracy of our research, we adopted an alternative new technique, texture analysis, to analyze and ... Padhani AR, Miles KA Multiparametric imaging of tumor response to therapy Radiology 2010;256:348–64 26 Yanagisawa M, et al Bevacizumab improves the delivery and efficacy of paclitaxel Anti-Cancer...
Ngày tải lên: 03/07/2020, 01:25
Báo cáo hóa học: " Research Article A Novel Approach to Detect Network Attacks Using G-HMM-Based Temporal Relations between Internet Protocol Packets" pot
... the total number of normal data The false negative rate is defined as the total number of attack data that were incorrectly classified as normal traffic divided by the total number of attack data 7.1 ... learning dataset with above-described dataset This dataset had 100,000 normal packets and 1,000 to 1,500 abnormal packets for training and evaluating each In the case of unsupervised learning algorithms ... because each data value is too small or too few points are assigned to a cluster center due to a bad initialization of the means In case of internet traffic, this problem can also occur because each...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
... based on the Remez exchange algorithm With the mentioned approaches a filter group EURASIP Journal on Advances in Signal Processing delay can always be obtained that ranges below the group delay ... that the tolerance mask is not always touched by the magnitude response In some regions the magnitude response ranges far below the allowed attenuation, which can be traced back to the fact that ... yield a convex optimization problem 3.2.1 Passband Narrow-band low-pass filters usually not exhibit a distinctive passband In order to obtain a narrowband low-pass filters it is sufficient to ask for...
Ngày tải lên: 21/06/2014, 19:20
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx
... available silicon area (hardware capacity), B. Knerr et al. 3 memory (software capacity), and latency as a timing con- straint. The global criticality/local phase (GCLP) algorithm is basically ... (b) according to ASAP and ALAP schedule. sequential device. It has to be stated that T min and T total are lower and upper bounds since their exact calculation in most cases is a hard optimisation ... of a functional part, for example, performing an FIR or CRC, as a dedicated hardware unit that features a high throughput and can be very power efficient. On the other hand, a custom data path...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... metalloproteinase 9 (96-kd gelatinase B) in human rheumatoid arthritis. Arthritis Rheum 1996, 39:1576-1587. 3. Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... La Fondation Armand-Frappier and the Canadian Arthritis Network. References 1. Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular ... spondylitis and reactive arthritis. A patient with features of more than one rheumatic disease (e.g. OA and crystal-induced arthritis) was classified as having the disease that clinically predominated at...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf
... [6,9], and variation of intercellular lipids [10], to name a few As such, a wide variety of physiological and pathological conditions can be analyzed, in a more systematic and practical way Theory ... this comparison, we are able to address the head pressure contours as part of a family of solutions Thus, quantitative arbitrary values of pressure always result in the same qualitative features ... Zurich, Mattenstrasse 26, 4058 Basel, Switzerland Department of Earth Sciences, Simon Fraser University, Burnaby, BC, V 5A 1S6, Canada Abstract Background: The potential of using skin as an alternative...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps
... the pax6 dataset Block Consensus sequence and possible binding sites pax6 1.1 (UCSC) CTTAATGATGAGAGATCTTTCCGCTCATTGCCCATTCAAATACAATTGTAGATCGAAGCCGGCCTT GTCAsGTTGAGAAAAAGTGAATTTCTAACATCCAGGACGTGCCTGTCTACT ... (0.930) pax6 2.4 (-) GGTTGCTTTCAGGTwTAATTAACTTTGAACAACAAATA Nkx2-5, M00241, CWTAATTG: 16-23 - (0.902) pax6 3.1 (UCSC) TTGTAATTACTGCCCTTCATGTGGTCCGGTGCCTTGAACCATCTTTAATTAAAAGCATAATTAAGG AML- 1a, M00271, ... (0.948) GATA-3, M00077, NNGATARNG: 4-12 - (0.917) SRY, M00148, AAACWAM: 7-13 + (0.917) pax6 1.6 (UCSC) CAsGTTGAGAAAAAGTGAATTTCTAACATCCAGGACGTGCCTGTCTACTTTCAGw GAATTGCATCCAATCACCCCCAGGGAATTCnGCTAATGTCTCC...
Ngày tải lên: 14/08/2014, 16:20
A markovian approach to the analysis and optimization of a portfolio of credit card accounts
... Markovian approach to the analysis and optimization of a portfolio of credit card accounts. A general framework is presented and some of the industrial practices are reaffirmed via simulations. A ... the author’s command of the English language. The author would also like to thank his parents for their constant support and care. Abstract This thesis introduces a novel approach to the analysis ... Hsieh. An integrated data mining and behavioral scoring model for analyzing bank customers. Expert Systems with Applications, 27:623–633, 2004. [23] E. A. Joachimsthaler and A. Stam. Mathematical...
Ngày tải lên: 16/09/2015, 14:04
Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications
... Lebensmittelwissenschaften (IEL) an der Landwirtschaftlichen Fakultät der Rheinischen Friedrich-Wilhelm-Universität Bonn Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors ... Staunen ist der Anfang der Erkenntnis Platon (ca 427 v.Chr - 347 v.Chr.) Summary Background and Aim: Ingestion of probiotics can modify gut microbiota and alter insulin resistance and diabetes development ... that daily intake of Lactobacillus (L.) reuteri increases insulin sensitivity by changing cytokine release and insulin secretion via modulation of glucagon-like peptide (GLP-1, GLP-2) release...
Ngày tải lên: 19/11/2015, 16:47
The breakfast club for 40 somethings a novel approach to unlearning money and reinventing your life
... experience to truly understand what brings you happiness and what really matters When you have clarity around how you want to live long term, you can then start to make a plan toward it Without that ... she had any more time to check Brad out Jasper was fit and he had always been athletic, but Brad Malone took that to a whole new level The guy was Hollywood fit, and the less Jayne saw of that ... seem, and Karen and Russ face challenges that are familiar to so many of us — juggling parenting, ageing parents, money pressures and work hassles Here are their vital stats: married for 17 years...
Ngày tải lên: 03/01/2020, 10:40
Synergisms of genome and metabolism stabilizing antitumor therapy (GMSAT) in human breast and colon cancer cell lines: A novel approach to screen for synergism
... read and approved the manuscript Funding Jonas Parczyk received a 6-month scholarship by the Berlin Institute of Health during his doctoral thesis Availability of data and materials All data ... https://www.cancer.org/content/dam/cancer-org/research/cancer-factsand-statistics/annual-cancer-facts-and-figures/2018/cancer-facts-andfigures-2018.pdf Güth U, Magaton I, Jane D, Fisher R, Schötzau A, Vetter M Primary and secondary distant metastatic breast ... (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data Ruhnau et al BMC Cancer (2020) 20:617 Background...
Ngày tải lên: 06/08/2020, 05:17
TRAIL-induced programmed necrosis as a novel approach to eliminate tumor cells
... (even a small) apoptotic caspase activation would ultimately translate into activation of caspase-3 and thus into an accumulation of cleavage fragments of PARP-1 and caspase-3 However, this was ... Kumar A, Eby MT, Sinha S, Jasmin A, Chaudhary PM: The ectodermal dysplasia receptor activates the nuclear factor-kappaB, JNK, and cell death pathways and binds to ectodysplasin A J Biol Chem 2001, ... and DA designed research; SV, SP, PD and SWM performed research; SV, SP, SWM, CR, CA, AT, DK, SS, HK and DA analyzed data, SV and DA wrote the paper All authors read and approved the final manuscript...
Ngày tải lên: 05/11/2020, 01:07
A Novel Approach to the Part Orientation Problem for Robotic Asse
... to aid in part manipulation The end-effector can be designed as part of the overall system as opposed to a separate entity • A dynamic analysis was completed to determine the required resistance ... assembly tasks take place along a non-vertical axis To account for non-vertical axis assembly, parts must be fed in a proper orientation to allow for correct assembly Parts feeders and specialized ... gripper may cause overshoot This can be determined by using a standard dynamic analysis 6.2.2 Kinematic Analysis This thesis outlined three related path planning algorithms that may be used to obtain...
Ngày tải lên: 25/10/2022, 03:18
protein rethreading a novel approach to protein design
... Protein topology diagrams were prepared with TopDraw31 Data collection and refinement statistics are shown in Table 1 The data was complete to 1.7 Å, but significant data was measured to higher ... of a cryo protectant since the crystallization condition had a high concentration of PEG Data collection was carried out at the 22-ID beamline at the Advanced Photon Source (Argonne National Laboratory) ... www.nature.com/scientificreports OPEN Protein rethreading: A novel approach to protein design Sayeh Agah*, Sandra Poulos*, Austin Yu, Iga Kucharska & Salem Faham received: 08 October 2015 accepted:...
Ngày tải lên: 04/12/2022, 16:06
A novel approach to automatic detection
... Committee Assoc Prof Dr Hasan Abdullah (BL), Assist Prof Dr Alias Abdulrahman (MAL), Assist Prof Dr Abdullah Aksu, (TR); Prof Dr Hasan Atar (TR), Prof Dr Lale Balas (TR), Prof Dr Levent Bat (TR), Assoc ... proposed algorithm will be improved and research will continue using different face databases Fig 8a The application of Harris operator on test data b The application of Fast operator on test data c ... Sci and Softw Eng 2(1):1-8 Samal, A and Iyengar, P .A (1992) Automatic recognition and analysis of human faces and facial expressions: a survey, Pattern Recognition, 25 (1): 65-77 Savran,N A. , Dibeklioğlu,...
Ngày tải lên: 10/02/2023, 19:53
Textbook of Sports Medicine Basic Science and Clinical Aspects of Sports Injury and Physical Activity pot
... pharmacologic autonomic blockade and analysis of HRV indicate that increases in cardiac parasympathetic (vagal) tone make an important contribution to resting bradycardia [,] The chronic increase ... due to low arterial pH, such low Pa2 values translate into arterial O2 saturations of % or less The cause of this arterial desaturation and failure of gas exchange has been debated, but Cardiovascular ... compared to the sedentary person whose stroke volume plateaus at submaximal intensities and may fall as maximal exertion is approached [] Myocardial vascularization and perfusion In a comparison...
Ngày tải lên: 15/03/2014, 09:20
Novel Insights on Chronic Kidney Disease, Acute Kidney Injury and Polycystic Kidney Disease Edited by Soundarapandian Vijayakumar pdf
... K Maesaka, Louis Imbriano, Shayan Shirazian and Nobuyuki Miyawaki Chapter Epidemiology, Causes and Outcome of Obstetric Acute Kidney Injury 67 Namrata Khanal, Ejaz Ahmed and Fazal Akhtar Part ... 207-214 Kajbafzadeh, A M., Javan-Farazmand, N., Motamedi, A. , Monajemzadeh, M., & Amini, E (2011) The optimal dose of Adriamycin to create a viable rat model potentially applicable to congenital obstructive ... M., Watarai, Y., Hoshii, S., Obikane, K., Nakashima, T., Sasaki, S., & Nonomura, K (2009) Pediatric kidney transplantation is safe and available for patients with urological anomalies as well as...
Ngày tải lên: 23/03/2014, 17:20
Sport, Professionalism and Pain: Ethnographies of injury and risk doc
... Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloging in Publication Data A catalog record for this book has ... their approach to the game is likely to shift from that of the devotee to that of the dabbler Time management at work as well as injury (see Chapters and 5) and age may also be factors that will ... Yorkshire and Lancashire had a large industrial middle class which was eager to exploit the business potential of the game and as a result initiated an earlier and more distinct transformation from pastime...
Ngày tải lên: 30/03/2014, 02:20
báo cáo hóa học: " The Dutch version of the knee injury and osteoarthritis outcome score: A validation study" pdf
... for a break between the factors with relatively large eigenvalues and those with smaller eigenvalues Factors that appeared before the break were assumed to be meaningful, and factors that appeared ... Results are presented as median (range) or mean ± SD Abbreviations: OA; osteoarthritis, TKA; total knee arthroplasty, Revision of TKA; Revision of total knee arthroplasty; VAS, Visual Analogue Scale; ... structure and factor loadings after varimax rotation Items with a factor loading less than 0.50 on all factors could be considered for exclusion In other words factor analysis was performed in order to...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " Interleukin-1alpha expression precedes IL-1beta after ischemic brain injury and is localised to areas of focal neuronal loss and penumbral tissues" pdf
... microglia 4h post-MCAo in the ipsilateral (Ai) but not the contralateral (ii) hemisphere Confocal image shows the colocalization of IL-1α and Iba-1 stains in an activated microglia in the ipsilateral ... IL-1β after ischemic brain injury and is localised to areas of focal neuronal loss and penumbral tissues Nadia M Luheshi1, Krisztina J Kovács2, Gloria Lopez-Castejon1, David Brough1#* and Adam Denes1,2#* ... key mediator of the sterile inflammatory response Findings Inflammation is recognised as a major contributor to the worsening of acute brain injury [1] In particular two pro-inflammatory members...
Ngày tải lên: 19/06/2014, 22:20