... cell shape, for example Understanding of pathways leading to targeted and combination therapies How biochemical pathways can be used to find new therapeutics was illustrated by David Lane (University ... ovarian cancer patients with resistance to carboplatin Ashworth also addressed a question that frequently arises when discussing resistance to therapies - whether resistance arises through a ... lethality screen, in which the cell, already sensitized to DNA damage by loss of BRCA1/2, is overwhelmed by the combination of a chemotherapeutic agent that causes DNA damage and a compound that...
Ngày tải lên: 14/08/2014, 08:21
... chain was represented as a concept vector in concept vector space, and the overall text vector was made up of those concept vectors The semantic importance of concepts and words was normalized according ... information retrieval are based on the statistic method We propose an approach that changes the basic index term weighting method by considering semantics and concepts of a document In this approach, ... we can not deal all the concept of a document, we discriminate representative chains from lexical chains Representative chains are chains delegated to represent a representative concept of a document...
Ngày tải lên: 23/03/2014, 19:20
Báo cáo hóa học: " Research Article A Novel Approach to Detect Network Attacks Using G-HMM-Based Temporal Relations between Internet Protocol Packets" pot
... the total number of normal data The false negative rate is defined as the total number of attack data that were incorrectly classified as normal traffic divided by the total number of attack data 7.1 ... learning dataset with above-described dataset This dataset had 100,000 normal packets and 1,000 to 1,500 abnormal packets for training and evaluating each In the case of unsupervised learning algorithms ... because each data value is too small or too few points are assigned to a cluster center due to a bad initialization of the means In case of internet traffic, this problem can also occur because each...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
... that the tolerance mask is not always touched by the magnitude response In some regions the magnitude response ranges far below the allowed attenuation, which can be traced back to the fact that ... delay yields a smoothing effect In the stopband the group delay is apparently not minimized at all Therefore the stopband can be regarded as a “do not care” region thus increasing the available degrees ... yield a convex optimization problem 3.2.1 Passband Narrow-band low-pass filters usually not exhibit a distinctive passband In order to obtain a narrowband low-pass filters it is sufficient to ask for...
Ngày tải lên: 21/06/2014, 19:20
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx
... , Ttotal − Tmin RA = Alimit , Atotal RS = Slimit Stotal (8) The totalised values for area Atotal , code size Stotal , and execution time Ttotal are simply built by the sum of the maximum gate ... l n k g m ALAP stalap (b) Figure 9: Two different start times for process (b) according to ASAP and ALAP schedule sequential device It has to be stated that Tmin and Ttotal are lower and upper ... task graphs, Mei et al [11] published a basic GA approach for the binary partitioning in a very similar setting to our work, and Zou et al [18] demonstrated a genetic algorithm with a finer granularity...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx
... liver parenchyma Br J Surg 1999, 86:784-788 Kokudo N, Tada K, Seki M, Ohta H, Azekura K, Ueno M, Ohta K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: ... Preoperative portal vein embolization for extension of hepatectomy indications Hepatology 1996, 24:1386-1391 Imamura H, Shimada R, Kubota M, Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: ... M, Miyagawa S, Kakazu T: Radical operation after portal embolization for tumor of hilar bile duct J Am Coll Surg 1994, 178:480-486 Kawasaki S, Makuuchi M, Kakazu T, Miyagawa S, Takayama T, Kosuge...
Ngày tải lên: 09/08/2014, 04:21
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases and tissue inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis ... Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular cartilage and synovial fluids of patients with rheumatoid arthritis Clin Rheumatol ... MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and OA [2-4]...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx
... serosanguinous fluid was aspirated (Figure 3) Dramatic pain relief was noted after aspiration An elastic stocking was applied to his left calf area after aspiration and follow-up two weeks later ... muscle Am J Sports Med 1977, 5:191-193 Takebayashi S, Takasawa H, Banzai Y, Miki H, Sasaki R, Itoh Y, Matsubara S: Sonographic findings in muscle strain injury: clinical and MR imaging correlation ... machine and S12 5–12 MHz real-time linear–array transducer (Philips Medical Systems) were used to examine the patient After careful examination, bilateral symmetrical sonographic findings of the calf...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx
... necessary for B-cell activation and contributes to a prolongation of Bcell antigen receptor signaling Thus, CR2 plays an important role in B-cell activation and combines the innate and adaptive arms ... regulated This regulation is mediated by proteins such as cell surface-like membrane cofactor protein (MCP), decay accelerating factor (DAF) and protectin (CD59), and the soluble factor H(fH) that ... protection against invading pathogens but also interacts with the adaptive immune system to optimize the pathogen-specific humoral and cellular defense cascade in the body, especially for viral pathogens...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc
... necessary for B-cell activation and contributes to a prolongation of Bcell antigen receptor signaling Thus, CR2 plays an important role in B-cell activation and combines the innate and adaptive arms ... regulated This regulation is mediated by proteins such as cell surface-like membrane cofactor protein (MCP), decay accelerating factor (DAF) and protectin (CD59), and the soluble factor H(fH) that ... protection against invading pathogens but also interacts with the adaptive immune system to optimize the pathogen-specific humoral and cellular defense cascade in the body, especially for viral pathogens...
Ngày tải lên: 12/08/2014, 04:22
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf
... this comparison, we are able to address the head pressure contours as part of a family of solutions Thus, quantitative arbitrary values of pressure always result in the same qualitative features ... through appendages such as hair follicles and sweat glands Although the relative importance of each is still not clear, there is a general consensus that the intercellular pathway plays a major ... media as applied to groundwater flow modelling [15,16] Following such an approach, geologic materials -and in our case the SC- may Page of 25 Marquez-Lago et al Theoretical Biology and Medical...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps
... TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGCGGA TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG ... GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG ... TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TAGCCCACGACAGCCAAATAATAATGAATCATTTCATAAATAATGGGTTTAGGGGCTTATCGGGA Rn Mm Pt Hs Fr GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG...
Ngày tải lên: 14/08/2014, 16:20
Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications
... CAC GAG CTG ACG ACA RCC ATG CA 23 nt tuf-F TGG TCA GGT ACT GGC TAA GC 20 nt tuf-R TCT TTG GAC AGA ATG TAC ACT TCA 24 nt tuf-S CCA TCA AGC CGC ACA CCA AGT TCG 24 nt Lacto-F2 TGG AAA CAG ATG CTA ... ATA CCG 21 nt Lacto-R2 CGT CCA TTG TGG TAG ATT CCC T 22 nt Lacto-S CTG AGA CAC GGC CCA WAC TCC TAC GG 26 nt F_reut_IS ACC GAG AAC AAC GCG TTA TTT 21 nt R_reut_IS CAT AAC TTA ACC TAA ACA ATC AAA ... clinical trial, assigned according to the randomization list The appropriate package was handed to the particular participant Statistical data analysis and power calculation Statistical data analysis...
Ngày tải lên: 19/11/2015, 16:47
RECTAL CANCER – A MULTIDISCIPLINARY APPROACH TO MANAGEMENT pot
... Abreu, Eduarda Matos, Fernando Castro Poças, Rosa Rocha and Jorge Pinto Chapter Opportunistic Screening for Colorectal Cancer Xu An-gao Chapter Crohn’s Disease and Colorectal Cancer 29 Andrea ... 251 Chapter 14 Role of Tumor Tissue Analysis in Rectal Cancer Pharmacogenetics 253 Emilia Balboa, Goretti Duran, Maria Jesus Lamas, Antonio Gomez-Caamaño, Catuxa Celeiro-Muñoz, Rafael Lopez, Angel ... MicroRNAs and Rectal Cancer 295 Miroslav Svoboda and Ilona Kocakova Chapter 17 Nonoperative Management of Distal Rectal Cancer After Chemoradiation: Experience with the “Watch & Wait” Protocol 317 Angelita...
Ngày tải lên: 27/06/2014, 19:20
A novel approach, using regional climate model, to derive present and future intensity duration frequency curves
... GCMs so that a bandwidth of uncertainties can be assessed to create appropriate and effective adaptation strategies to address climate change and its impacts Same approach can also be applied for ... xxxvi ACRONYMS AND ABBREVIATION ADB Asian Development Bank AGCM Atmospheric General Circulation Model AMS Annual Maximum Rainfall Series AOGCM Atmospheric Ocean General Circulation Model APHRODITE ... APHRODITE Asian Precipitation Highly Resolved Observational Data Integration Towards the Evaluation of Water Resources AR4 Fourth Assessment Report CCC Canadian Climate Centre CCCMA Canadian Climate...
Ngày tải lên: 08/09/2015, 21:39
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model
... Materials and Methods Statistical analysis Data are presented as mean ± SE Statistical significance was analyzed by variance (ANOVA), a Tukey test was applied when necessary for comparisons A value ... so as to calculate the total wound area (i.e L x B) A mathematic model was applied to determine the time to half wound healing In the exponential phase starting from Day 3, the change in area ... area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the percentage of the original area for each group of rats The data of 6th day suggests the largest...
Ngày tải lên: 26/09/2015, 09:39
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... able to create meaningful data valid in large scale analyses (across herds and veterinary practices) Such veterinarians would generally want to focus on possibilities for across-herd data analyses ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters ... Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 cal analyses in the future, and they are highly motivated to use, for instance, multi-factorial analysis...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo y học: " A Practical Approach to Managing Patients with HCV Infection"
... correlates poorly with liver histology, the ratio of aspartate aminotransferase (AST) to alanine aminotransferase (ALT) >1 is a dependable marker for cirrhosis [28,29] Increased INR and thrombocytopenia ... HCC, and mortality In addition, HCV infection has been linked to a variety of extra-hepatic manifestations such as autoimmune diseases, lymphoma, monoclonal gammopathies and cryoglobulinemia Some ... regardless of treatment candidacy Alcohol abstinence should be recommended to all patients as this may accelerate the progression of liver disease Hepatotoxic drugs should also be avoided, as patients...
Ngày tải lên: 02/11/2012, 09:51
Báo cáo y học: "A Practical Approach to Management of Chronic Hepatitis B"
... (IFN) alfa-2b, lamivudine (LAM), and adefovir (ADV) [1-3, 7-10] Table summarizes a comparison of these three therapeutic agents Interferon (IFN) alfa-2b As a potent immune modulator, IFN has both ... years, ALT has been used as a standard surrogate for the activity of CHB Thus, ALT level in combination with HBV DNA level and histological activity has been used as a determinant for HBV treatment ... normal transaminases have historically not been considered as candidates for HBV treatment based on the assumption that these patients usually have a slow progression and evidence that these patients...
Ngày tải lên: 03/11/2012, 09:41