... were obtained from Qiagen (Valencia, California, USA) The siRNA target sequences were as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT; CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C, AACTGAAGAAGCAGTCGCAAGT; CHK1-D, ... CHK1 as a sensitizing target for improving Figure Validation of CHK1 as a sensitizing target to gemcitabine in pancreatic cancer cells Validation of CHK1 as a sensitizing target to gemcitabine in ... R, Passardi A, Zerbi A, Balzano G, Aldrighetti L, Staudacher C, Villa E, Di Carlo V: Gemcitabine versus cisplatin, epirubicin, fluorouracil, and gemcitabine in advanced pancreatic cancer: a randomised...
Ngày tải lên: 18/06/2014, 15:20
... Cancer 2004, 101:2727-2736 Matsuo Y, Sawai H, Funahashi H, Takahashi H, Sakamoto M, Yamamoto M, Okada Y, Hayakawa T, Manabe T: Enhanced angiogenesis due to inflammatory cytokines from pancreatic ... promotes pancreatic cancer cell invasion Cancer J 2004, 10:374-380 Campbell AS, Albo D, Kimsey TF, White SL, Wang TN: Macrophage inflammatory protein-3alpha promotes pancreatic cancer cell invasion ... receptor in human pancreatic cancer Int J Cancer 1999, 81:650-657 Kimsey TF, Campbell AS, Albo D, Wilson M, Wang TN: Co-localization of macrophage inflammatory protein-3alpha (Mip-3alpha) and its...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: "A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" ppt
... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal of Translational ... 319:525-532 Macarulla T, Ramos FJ, Capdevila J, Saura C, Tabernero J: Novel targets for anticancer treatment development in colorectal cancer Clin Colorectal Cancer 2006, 6:265-272 Voutsadakis IA: Pathogenesis...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" A predicted protein, KIAA0247, is a cell cycle modulator in colorectal cancer cells under 5-FU treatment" doc
... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal of Translational ... 319:525-532 Macarulla T, Ramos FJ, Capdevila J, Saura C, Tabernero J: Novel targets for anticancer treatment development in colorectal cancer Clin Colorectal Cancer 2006, 6:265-272 Voutsadakis IA: Pathogenesis...
Ngày tải lên: 20/06/2014, 03:20
báo cáo khoa học: "Clusterin confers gmcitabine resistance in pancreatic cancer" pps
... these agents [26] The actual mechanisms for pancreatic cancer to resist gmcitabine are unclear Xie, et al has found [27] clusterin was overexpressed in pancreatic cancer tissues and pancreatic cancer ... Capan-1 and PancTu-1) using a monoclonal antibody specific for the clusterin a chain As a protein loading control, the same blot was incubated with an anti-GAPDH monoclonal antibody C, Correlation ... targeting clusterin gene in an intravesical administration model against human bladder cancer kotcc-1 cells J Urol 2004, 171:2477-81 14 Muramaki M, So A, Hayashi N, Sowery R, Miyake H, Fujisawa...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: "Period-2: a tumor suppressor gene in breast cancer" pdf
... p53 can induce a transient arrest in G1 in cells, allowing cells time to repair damaged DNA [35] Activated p53 can also eliminate cells through mechanisms involving prolonged arrest in G1 and induction ... cells leading to an alteration in the cell cycle, cell growth, and cell survival Materials and methods Human breast cancer and breast epithelial cell lines The human breast cancer cell line MDA-MB-231 ... Boulares AH, Yakovlev AG, Ivanova V, Stoica BA, Wang G, Iyer S, Smulson M: Role of poly(ADP-ribose) polymerase (PARP) cleavage in apoptosis Caspase 3-resistant PARP mutant increases rates of apoptosis...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo khoa học: "Bench-to-bedside review: Thrombocytopenia-associated multiple organ failure – a newly appreciated syndrome in the critically ill" pdf
... Disseminated intravascular coagulation: Pathophysiologic mechanisms and manifestations Semin Thromb Haemostas 1998, 24:3 Bick RL: Disseminated intravascular coagulation: Objective clinical and laboratory ... Therapies used to stop fibrinolysis include aminocaproic acid, tranexamine, and aprotinin PAI, plasminogen activator inhibitor type I detergent) plasma because these plasma products are poor in ... antithrombin III levels are low Also, combined use of heparin and antithrombin III concentrate can cause an increased tendency to bleeding and actually increase mortality Prostacyclin infusion can improve...
Ngày tải lên: 13/08/2014, 03:20
Characterization of TROM, a novel transcription repressor in human cancers identified by modified suppression subtractive hybidization (MSSH)
... presented and discuss in Chapter Section Introduction Figure 1.3 a T7 promoter TAATACGACTCACTATAGGGAGA SP6 promoter ATTTAGGTGACACTATAGAAGNG T3 promoter AATTAACCCTCACTAAAGGGAGA b Figure 1.3 Paradigm ... fifth cause of death among all cancers The annual incidence is increasing at a rate of 0.5% globally, and at 4% in Asia, making the estimated new cases at 1.5 million in year 2010 (1) At present, ... 1.5) Among males, the most common cancers are lung and stomach cancer, while breast cancer and cervical carcinoma topped the chart for females All together, lung, colorectal and stomach cancers are...
Ngày tải lên: 12/09/2015, 09:59
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx
... β-actin mRNA and AMACR mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) In contrast, the AMACR mRNA ... immunohistochemical staining In contrast, PSA was stained in both prostate cancer tissue and non-cancerous tissue (Figure 2C) These data indicated that AMACR had a mostly cancer- specific expression profile at ... release assay at the indicated effector /target ratios AMACR-derived peptides might serve as a cancer vaccine for HLA -A2 4-positive prostate cancer patients It is possible that AMACR-targeting therapy...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo khoa học: "Proposing the lymphatic target volume for elective radiation therapy for pancreatic cancer: a pooled analysis of clinical evidence" ppsx
... area between the abdominal aorta and the inferior vena cava (Area inter) (metastatic rate of pancreatic head cancer: Area pre-aor 8.6%, Area inter 11.7%; metastatic rate of pancreatic body/tail ... pancreatic cancer A study of autopsy material Ann Surg 1986, 204:65-71 25 Kayahara M, Nagakawa T, Futagami F, Kitagawa H, Ohta T, Miyazaki I: Lymphatic flow and neural plexus invasion associated ... body/tail cancer: Area pre-aor 13%, Area inter 13%), while other areas including those posterior and lateral to the aorta and the vena cava and those anterior to the vena cava had
Ngày tải lên: 09/08/2014, 08:23
Báo cáo khoa học: "Gemcitabine/cisplatin versus 5-fluorouracil/ mitomycin C chemoradiotherapy in locally advanced pancreatic cancer: a retrospective analysis of 93 patients" pptx
... continual reassessment strategy for dose escalation of cisplatin combined with gemcitabine and radiation therapy in pancreatic cancer JClinOncol 2004, 22:238-243 Heinemann V, Labianca R, Hinke A, ... Louvet C: Increased survival using platinum analog combined with gemcitabine as compared to singleagent gemcitabine in advanced pancreatic cancer: pooled analysis of two randomized trials, the ... evaluation of benefit from gemcitabine-based combination chemotherapy applied in advanced pancreatic cancer BMC Cancer 2008, 8:82 Crane CH, Janjan NA, Evans DB, Wolff RA, Ballo MT, Milas L, Mason...
Ngày tải lên: 09/08/2014, 09:20
INHIBITION OF APE1’S DNA REPAIR ACTIVITY AS A TARGET IN CANCER: IDENTIFICATION OF NOVEL SMALL MOLECULES THAT HAVE TRANSLATIONAL POTENTIAL FOR MOLECULARLY TARGETED CANCER THERAPY
... radiation therapy are the mainstream treatment options available to treat cancers Many chemotherapeutic drugs act by damaging DNA, which leads to an accumulation of damage resulting in impaired ... unconditionally welcoming me into your family and for always treating me like a daughter and a sister Lastly and most importantly, I want to acknowledge my mum Ranjana Bapat and my late father, Ajit Bapat ... in India, for being so encouraging and for always believing in me To my parents -in- law, Capt Prafull Bhate and Dr Jyotsna Bhate and my brother and sister -in- law, Anmol and Rama Bhate: thank you...
Ngày tải lên: 24/08/2014, 13:10
Tài liệu Business Ethics: A MANUAL FOR MANAGING A RESPONSIBLE BUSINESS ENTERPRISE IN EMERGING MARKET ECONOMIES pptx
... Organizational Learning,” emphasizes the importance of evaluating a business ethics program as an integral part of organizational learning and of what it means to be an RBE How to Use this Manual The audience ... corporations • Laws on privatization • Real estate laws • Laws against unfair competition Chapter 1: Conduct in an Emerging Market Economy 15 • Labor–management laws • Tax laws • Accounting and auditing ... program design and implementation, from defining key terms and addressing global standards and best practices, through evaluating the business ethics program as a part of organizational learning...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Autosomal-recessive genes in Parkinson’s disease – a common pathway? docx
... 1560–1567 Schapira AH (2008) Mitochondria in the aetiology and pathogenesis of Parkinson’s disease Lancet Neurol 7, 97–109 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Saito M, Maruyama M, Takahashi ... cellsignalling cascades including MAPK and phosphatidylinositol 3-kinase (PI3K) pathways that can target HtrA2, PINK1, Parkin and DJ-1 Likely these PD-associated proteins are part of a complex network including ... genes in Parkinson’s disease contains a putative catalytic serine–threonine kinase domain and shares homology with calmodulin-dependant protein kinase In addition, preliminary evidence by Valente...
Ngày tải lên: 18/02/2014, 14:20
Báo cáo khoa học: The calpain 1–a-actinin interaction Resting complex between the calcium-dependant protease and its target in cytoskeleton doc
... fashion, and the C-terminal part (domains III–IV) of the 80 kDa subunit, are implicated in the interface linking calpain to skeletal muscle a- actinin Colocalization of microcalpain and a- actinin in ... a calpain binding site in the C-terminal domain of smooth muscle a- actinin Involvement of the C-terminal domain of ask in Calp1 binding In order to locate the region responsible for the binding ... phase immunoassay (ELISA) between coated 30 (u), 60 (j) and 10 kDa (s) ask fragments and increasing amounts of biotin-labelled Calp1 Binding was determined at 405 nm using streptavidin–alkaline...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: A study of microRNAs in silico and in vivo: diagnostic and therapeutic applications in cancer pot
... microRNA polycistron as a potential human oncogene Nature 435, 828–833 39 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi T (2005) A ... tissues in various cancer types, including CLL, breast cancer, glioblastoma, thyroid papillary carcinoma, hepatocellular carcinoma, lung cancer, colon cancer and endocrine pancreatic tumors [8,17–22,26,45,52–54] ... Family Professor of Cardiovascular Research at the Mayo Clinic SAW is a paid consultant to Merck References American Cancer Society (2006) Cancer Statistics 2006 American Cancer Society, Atlanta,...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx
... separated by SDS/PAGE and analysed by Western-blot using a Gq/11 a antiserum (Fig 1) Crude homogenates of male and female antennae contained an immunoreactive band with an apparent molecular mass ... a M, molecular markers Left (A, B,C) Coomassie stain after 10% SDS/PAGE of antennal and cell culture homogenates (A) Male M brassicae (4 antennae equivalent), (B) female M brassicae (6 antennae ... familiaris (Q28294) and human (P50148) Several motifs indicative of this Ga family are conserved: N-terminal cysteines, arginine177, and a GAG box A domain, with the characteristic residues underlined...
Ngày tải lên: 17/03/2014, 23:20
To amend the Public Health Service Act to provide for a Pancreatic Cancer Initiative, and for other purposes. ppt
... of the National Cancer Institute in ac- cordance with paragraph (5) regarding the prioritization and award of National Institutes of Health research grants relating to pancreatic 10 cancer 11 ... promoting a cadre of new investiga- tors in the field of pancreatic cancer research; and ‘‘(C) increasing physician and public awareness of pancreatic cancer ‘‘(2) CONSULTATION. In carrying out ... CANCER INITIATIVE 14 ‘‘ (a) PANCREATIC CANCER INITIATIVE.— 15 ‘‘(1) ESTABLISHMENT.—The Secretary shall es- 16 tablish and implement a Pancreatic Cancer Initiative 17 to assist in coordinating activities...
Ngày tải lên: 22/03/2014, 17:20
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in ... drinking water taken orally twice a day The usual dose of Ca3(PO4)2 prescribed was grains (~0.324 g) taken orally twice a day Clinical features of patients with intracranial brain cancers The 15 patients ... stage of the disease when homeopathic treatment was started in Kolkata, India The patients gradually improved, as indicated by serial computed tomography scans and clinical examinations The major...
Ngày tải lên: 22/03/2014, 17:20
Báo cáo khoa học: Vitamin D stimulates apoptosis in gastric cancer cells in synergy with trichostatin A ⁄sodium butyrate-induced and 5-aza-2¢-deoxycytidine-induced PTEN upregulation ppt
... further investigations into the potential application of vitamin D as a novel molecular target in gastric cancer therapies in association with the use of TSA ⁄ NaBu and 5-Aza Results Vitamin D induced ... Sakata K, Nishizuka S, Maesawa C, Suzuki Y, Iwaya T, Terashima M, Saito K & Satodate R (1996) Inactivation of the E-cadherin gene in primary gastric carcinomas and gastric carcinoma cell lines ... shown as means ± standard deviations RNA isolation and quantitative real-time PCR Total RNA was extracted following the TaKaRa RNAiso Reagent manual, and reverse transcribed into cDNA using the...
Ngày tải lên: 22/03/2014, 21:20