... were obtained from Qiagen (Valencia, California, USA) The siRNA target sequences were as follows: CHK1 -A, AAGAAAGAGATCTGTATCAAT; CHK1-B, TTGGAATAACTCCACGGGATA; CHK1-C, AACTGAAGAAGCAGTCGCAAGT; CHK1-D, ... CHK1 as a sensitizing target for improving Figure Validation of CHK1 as a sensitizing target to gemcitabine inpancreaticcancer cells Validation of CHK1 as a sensitizing target to gemcitabine in ... R, Passardi A, Zerbi A, Balzano G, Aldrighetti L, Staudacher C, Villa E, Di Carlo V: Gemcitabine versus cisplatin, epirubicin, fluorouracil, and gemcitabine in advanced pancreatic cancer: a randomised...
... Cancer 2004, 101:2727-2736 Matsuo Y, Sawai H, Funahashi H, Takahashi H, Sakamoto M, Yamamoto M, Okada Y, Hayakawa T, Manabe T: Enhanced angiogenesis due to inflammatory cytokines from pancreatic ... promotes pancreaticcancer cell invasion Cancer J 2004, 10:374-380 Campbell AS, Albo D, Kimsey TF, White SL, Wang TN: Macrophage inflammatory protein-3alpha promotes pancreaticcancer cell invasion ... receptor in human pancreaticcancer Int J Cancer 1999, 81:650-657 Kimsey TF, Campbell AS, Albo D, Wilson M, Wang TN: Co-localization of macrophage inflammatory protein-3alpha (Mip-3alpha) and its...
... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal of Translational ... 319:525-532 Macarulla T, Ramos FJ, Capdevila J, Saura C, Tabernero J: Novel targets for anticancer treatment development in colorectal cancer Clin Colorectal Cancer 2006, 6:265-272 Voutsadakis IA: Pathogenesis...
... CTCATGCTTCTTTCAACAGTGG 82 F: CCATACCTCAAGTATTTGCCATC 67 R: TCCAGTCTTTCGTATTAATGATTCAG F: CATGGTGCACTTTCCTCCTT Cyclin B2 NM004701 F: GCATTATCATCCTTCTAAGGTAGCA (CCNB2) a R: TGTAATACTGCTGCTTTAAGTTCCA ... KIAA0247, in human gastrointestinal tissues and colonic cell lines Results indicated that KIAA0247 ubiquitously expresses in gastrointestinal tissues and in Huang et al Journal of Translational ... 319:525-532 Macarulla T, Ramos FJ, Capdevila J, Saura C, Tabernero J: Novel targets for anticancer treatment development in colorectal cancer Clin Colorectal Cancer 2006, 6:265-272 Voutsadakis IA: Pathogenesis...
... these agents [26] The actual mechanisms for pancreaticcancer to resist gmcitabine are unclear Xie, et al has found [27] clusterin was overexpressed inpancreaticcancer tissues and pancreaticcancer ... Capan-1 and PancTu-1) using a monoclonal antibody specific for the clusterin a chain As a protein loading control, the same blot was incubated with an anti-GAPDH monoclonal antibody C, Correlation ... targeting clusterin gene in an intravesical administration model against human bladder cancer kotcc-1 cells J Urol 2004, 171:2477-81 14 Muramaki M, So A, Hayashi N, Sowery R, Miyake H, Fujisawa...
... p53 can induce a transient arrest in G1 in cells, allowing cells time to repair damaged DNA [35] Activated p53 can also eliminate cells through mechanisms involving prolonged arrest in G1 and induction ... cells leading to an alteration in the cell cycle, cell growth, and cell survival Materials and methods Human breast cancer and breast epithelial cell lines The human breast cancer cell line MDA-MB-231 ... Boulares AH, Yakovlev AG, Ivanova V, Stoica BA, Wang G, Iyer S, Smulson M: Role of poly(ADP-ribose) polymerase (PARP) cleavage in apoptosis Caspase 3-resistant PARP mutant increases rates of apoptosis...
... Disseminated intravascular coagulation: Pathophysiologic mechanisms and manifestations Semin Thromb Haemostas 1998, 24:3 Bick RL: Disseminated intravascular coagulation: Objective clinical and laboratory ... Therapies used to stop fibrinolysis include aminocaproic acid, tranexamine, and aprotinin PAI, plasminogen activator inhibitor type I detergent) plasma because these plasma products are poor in ... antithrombin III levels are low Also, combined use of heparin and antithrombin III concentrate can cause an increased tendency to bleeding and actually increase mortality Prostacyclin infusion can improve...
... presented and discuss in Chapter Section Introduction Figure 1.3 a T7 promoter TAATACGACTCACTATAGGGAGA SP6 promoter ATTTAGGTGACACTATAGAAGNG T3 promoter AATTAACCCTCACTAAAGGGAGA b Figure 1.3 Paradigm ... fifth cause of death among all cancers The annual incidence is increasing at a rate of 0.5% globally, and at 4% in Asia, making the estimated new cases at 1.5 million in year 2010 (1) At present, ... 1.5) Among males, the most common cancers are lung and stomach cancer, while breast cancer and cervical carcinoma topped the chart for females All together, lung, colorectal and stomach cancers are...
... β-actin mRNA and AMACR mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) In contrast, the AMACR mRNA ... immunohistochemical staining In contrast, PSA was stained in both prostate cancer tissue and non-cancerous tissue (Figure 2C) These data indicated that AMACR had a mostly cancer- specific expression profile at ... release assay at the indicated effector /target ratios AMACR-derived peptides might serve as acancer vaccine for HLA -A2 4-positive prostate cancer patients It is possible that AMACR-targeting therapy...
... area between the abdominal aorta and the inferior vena cava (Area inter) (metastatic rate of pancreatic head cancer: Area pre-aor 8.6%, Area inter 11.7%; metastatic rate of pancreatic body/tail ... pancreaticcancerA study of autopsy material Ann Surg 1986, 204:65-71 25 Kayahara M, Nagakawa T, Futagami F, Kitagawa H, Ohta T, Miyazaki I: Lymphatic flow and neural plexus invasion associated ... body/tail cancer: Area pre-aor 13%, Area inter 13%), while other areas including those posterior and lateral to the aorta and the vena cava and those anterior to the vena cava had
... continual reassessment strategy for dose escalation of cisplatin combined with gemcitabine and radiation therapy inpancreaticcancer JClinOncol 2004, 22:238-243 Heinemann V, Labianca R, Hinke A, ... Louvet C: Increased survival using platinum analog combined with gemcitabine as compared to singleagent gemcitabine in advanced pancreatic cancer: pooled analysis of two randomized trials, the ... evaluation of benefit from gemcitabine-based combination chemotherapy applied in advanced pancreaticcancer BMC Cancer 2008, 8:82 Crane CH, Janjan NA, Evans DB, Wolff RA, Ballo MT, Milas L, Mason...
... radiation therapy are the mainstream treatment options available to treat cancers Many chemotherapeutic drugs act by damaging DNA, which leads to an accumulation of damage resulting in impaired ... unconditionally welcoming me into your family and for always treating me like a daughter and a sister Lastly and most importantly, I want to acknowledge my mum Ranjana Bapat and my late father, Ajit Bapat ... in India, for being so encouraging and for always believing in me To my parents -in- law, Capt Prafull Bhate and Dr Jyotsna Bhate and my brother and sister -in- law, Anmol and Rama Bhate: thank you...
... Organizational Learning,” emphasizes the importance of evaluating a business ethics program as an integral part of organizational learning and of what it means to be an RBE How to Use this Manual The audience ... corporations • Laws on privatization • Real estate laws • Laws against unfair competition Chapter 1: Conduct in an Emerging Market Economy 15 • Labor–management laws • Tax laws • Accounting and auditing ... program design and implementation, from defining key terms and addressing global standards and best practices, through evaluating the business ethics program as a part of organizational learning...
... 1560–1567 Schapira AH (2008) Mitochondria in the aetiology and pathogenesis of Parkinson’s disease Lancet Neurol 7, 97–109 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Saito M, Maruyama M, Takahashi ... cellsignalling cascades including MAPK and phosphatidylinositol 3-kinase (PI3K) pathways that can target HtrA2, PINK1, Parkin and DJ-1 Likely these PD-associated proteins are part of a complex network including ... genes in Parkinson’s disease contains a putative catalytic serine–threonine kinase domain and shares homology with calmodulin-dependant protein kinase In addition, preliminary evidence by Valente...
... fashion, and the C-terminal part (domains III–IV) of the 80 kDa subunit, are implicated in the interface linking calpain to skeletal muscle a- actinin Colocalization of microcalpain and a- actinin in ... a calpain binding site in the C-terminal domain of smooth muscle a- actinin Involvement of the C-terminal domain of ask in Calp1 binding In order to locate the region responsible for the binding ... phase immunoassay (ELISA) between coated 30 (u), 60 (j) and 10 kDa (s) ask fragments and increasing amounts of biotin-labelled Calp1 Binding was determined at 405 nm using streptavidin–alkaline...
... microRNA polycistron as a potential human oncogene Nature 435, 828–833 39 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi T (2005) A ... tissues in various cancer types, including CLL, breast cancer, glioblastoma, thyroid papillary carcinoma, hepatocellular carcinoma, lung cancer, colon cancer and endocrine pancreatic tumors [8,17–22,26,45,52–54] ... Family Professor of Cardiovascular Research at the Mayo Clinic SAW is a paid consultant to Merck References American Cancer Society (2006) Cancer Statistics 2006 American Cancer Society, Atlanta,...
... separated by SDS/PAGE and analysed by Western-blot using a Gq/11 a antiserum (Fig 1) Crude homogenates of male and female antennae contained an immunoreactive band with an apparent molecular mass ... a M, molecular markers Left (A, B,C) Coomassie stain after 10% SDS/PAGE of antennal and cell culture homogenates (A) Male M brassicae (4 antennae equivalent), (B) female M brassicae (6 antennae ... familiaris (Q28294) and human (P50148) Several motifs indicative of this Ga family are conserved: N-terminal cysteines, arginine177, and a GAG box A domain, with the characteristic residues underlined...
... of the National Cancer Institute in ac- cordance with paragraph (5) regarding the prioritization and award of National Institutes of Health research grants relating to pancreatic 10 cancer 11 ... promoting a cadre of new investiga- tors in the field of pancreaticcancer research; and ‘‘(C) increasing physician and public awareness of pancreaticcancer ‘‘(2) CONSULTATION. In carrying out ... CANCER INITIATIVE 14 ‘‘ (a) PANCREATICCANCER INITIATIVE.— 15 ‘‘(1) ESTABLISHMENT.—The Secretary shall es- 16 tablish and implement aPancreaticCancer Initiative 17 to assist in coordinating activities...
... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in ... drinking water taken orally twice a day The usual dose of Ca3(PO4)2 prescribed was grains (~0.324 g) taken orally twice a day Clinical features of patients with intracranial brain cancers The 15 patients ... stage of the disease when homeopathic treatment was started in Kolkata, India The patients gradually improved, as indicated by serial computed tomography scans and clinical examinations The major...
... further investigations into the potential application of vitamin D as a novel molecular targetin gastric cancer therapies in association with the use of TSA ⁄ NaBu and 5-Aza Results Vitamin D induced ... Sakata K, Nishizuka S, Maesawa C, Suzuki Y, Iwaya T, Terashima M, Saito K & Satodate R (1996) Inactivation of the E-cadherin gene in primary gastric carcinomas and gastric carcinoma cell lines ... shown as means ± standard deviations RNA isolation and quantitative real-time PCR Total RNA was extracted following the TaKaRa RNAiso Reagent manual, and reverse transcribed into cDNA using the...