a new therapeutic avenue in kidney protection

... test In all analyses, P < 0.05 was taken to indicate statistical significance Statistical analyses were performed using the statview 5.0 software package (Abacus Concepts, Calabasas, CA, USA) Acknowledgements ... 34 Harashima N, Kurihara K, Utsunomiya A, Tanosaki R, Hanabuchi S, Masuda M, Ohashi T, Fukui F, Hasegawa A, Masuda T et al (2004) Graft-versus-Tax response in adult T-cell leukemia patients after ... Y, Takagi H, Nakayama T, Yamakami K, Tadakuma T, Yokoyama N & Kojima N (2007) Intraperitoneal immunization with oligomannose-coated liposome-entrapped soluble leishmanial antigen induces antigen-specific...

Ngày tải lên: 14/03/2014, 23:20

... (Melan -A) (S):5’-TGACCCTACAAGATGCCAAGAG-3’, (AS): 5’-ATCATGCATTGCA ACATTTATTGATGGAG-3’ The real-time qRT-PCR was performed in single wells of a 96-well plate (BioRad, Hercules, California) in a 25 μl reaction ... isolated from patient 10820, 0% degranulated against antigen-deficient melanoma A3 75, 11% degranulated against A* 0201-positive melanocytes, 15% and 16% degranulated against melanoma lines Malme3M ... melanocyte cell line was analyzed using PCR-based analysis (Table 1) Melanocyte Page of 10 Table Summary of HLA -A2 status in neonatal melanocyte lines Melanocyte Line HLA -A2 status 3C0651 (-negative) 3C0659...

Ngày tải lên: 18/06/2014, 22:20

... (Melan -A) (S):5’-TGACCCTACAAGATGCCAAGAG-3’, (AS): 5’-ATCATGCATTGCA ACATTTATTGATGGAG-3’ The real-time qRT-PCR was performed in single wells of a 96-well plate (BioRad, Hercules, California) in a 25 μl reaction ... isolated from patient 10820, 0% degranulated against antigen-deficient melanoma A3 75, 11% degranulated against A* 0201-positive melanocytes, 15% and 16% degranulated against melanoma lines Malme3M ... melanocyte cell line was analyzed using PCR-based analysis (Table 1) Melanocyte Page of 10 Table Summary of HLA -A2 status in neonatal melanocyte lines Melanocyte Line HLA -A2 status 3C0651 (-negative) 3C0659...

Ngày tải lên: 20/06/2014, 04:20

... McClanahan T, Kastelein RA, Sedgwick JD, Cua DJ: Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation J Exp Med 2003, 198:1951-1957 Nakae S, Nambu A, Sudo ... mass is exemplified by individuals with high bone mass phenotypes having activating mutations in the Wnt pathway Wnt signalling is also involved in T cell development and osteoclastogenesis, and ... concentrations of many cytokines and growth factors undoubtedly influence differentiation pathways The Wnt pathway is essential for osteoblast differentiation, and its central role in regulating...

Ngày tải lên: 09/08/2014, 10:20

... of data for mice, a beneficial role for CTL activity in promoting clearance of influenza virus infection in human influenza cannot be assumed because influenza in humans is primarily an infection ... against influenza A infection by vaccination with vacciniainfluenza recombinants expressing hemagglutinin and neuraminidase J Immunol 1993, 150(12):5484-5493 Bender BS, Bell WE, Taylor S, Small PA ... Plasmid Purification kits The DNA was banded twice on CsCl2 gradients Vaccinia viral gene recombinants Thymidine kinase-negative (TK-) recombinant vaccinia virus expressing influenza A/ PR/8/34 NP...

Ngày tải lên: 12/08/2014, 15:20

... China (grant no 2007AA10Z110) References Okamuro JK, Caster B, Villarroel R, Van Montagu M & Jofuku KD (1997) The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis ... variations in binding affinity were caused by binding instability as a result of nonspecific interference, rather than the alternation of a binding site, we carried out the competition binding assay using ... the activation domain of viral protein 16 and the yeast GAL4 DBD The reporter and two effectors in a ratio of : : were cotransformed into plant tissue; the remainder was the same as in Fig flanking...

Ngày tải lên: 18/02/2014, 13:20

... using the dried droplet technique and a- cyano-4-hydroxycinnamic as matrix, and analysed by using a Voyager-DE PRO mass spectrometer (Applied Biosystems, Framingham, MA, USA) Internal-mass calibration ... performed a comparative bidimensional PAGE analysis of nuclear extracts coupled to Western blotting analysis with an eEF 1A mAb As an internal normalizer of loading amounts and focusing position, ... accompanied by a dramatic increase in protein methylation at as many as nine lysine residues, without any change in the protein or mRNA levels [43] This modification, as well as other post-translational...

Ngày tải lên: 21/02/2014, 00:20

... homology and -3 protein interaction domains that are important for kinase regulation, and a Tec homology domain containing one or two proline-rich regions that interact intra- or intermolecularly ... factor of activated T cells (NFAT) Diacylglycerol activates protein kinase Cs (in conjunction with Ca2+), as well as Ras–GRP, a major activator of the Ras–Raf–ERK pathway in T cells Mutation of ... evidence in humans and in mouse models has demonstrated that enhanced Th2 cytokine production is involved in atopic diseases, including allergies and asthma Th17 responses are highly proinflammatory and...

Ngày tải lên: 28/03/2014, 22:21

... Kurotaki T, Yamamoto M, Yagihashi A, Ohmura T, Yamaguchi K, Katsuramaki T, Yasoshima T, Sasaki K, Mizushima Y, Minamida H, Kimura H, Akiyama M, Hirohashi Y, Asanuma H, Tamura Y, Shimozawa K, Sato ... Hirohashi Y, Torigoe T, Sato Y, Tamura Y, Hariu H, Yamamoto M, Kurotaki T, Tsuruma T, Asanuma H, Kanaseki T, Ikeda H, Kashiwagi K, Okazaki M, Sasaki K, Sato T, Ohmura T, Hata F, Yamaguchi K, Hirata ... Pharmaceutical Co (Osaka, Japan) Human recombinant GM-CSF was a kind gift from Kirin (Tokyo, Japan) and Novartis Pharmaceutical (Basel, Switzerland) Human recombinant IL-4 and IL-7 were purchased from Invitrogen...

Ngày tải lên: 18/06/2014, 15:20

... PP 2A has been described as a negative regulator for the mitogen-activated protein kinases extracellular signal-related kinase and c-Jun Nterminal kinase, and these molecules are downregulated after ... I, Kanegae Y, Kawaguchi Y, Kitabatake A, Uede T: Successful gene therapy via intraarticular injection of adenovirus vector containing CTLA4IgG in a murine model of type II collageninduced arthritis ... CTLA-4 molecule binds the medium-chain subunit of the clathrin adaptor AP-2 This interaction leads to a rapid internalization of CTLA-4 and tight regulation of surface CTLA-4 CTLA-4 is also able...

Ngày tải lên: 09/08/2014, 01:23

... http://www.retrovirology.com/content/7/1/44 gravir-containing media were again used at a concentration of μM Integrated DNA qPCR For the integrated DNA qPCR assays, cellular DNA was extracted with a DNeasy blood and tissue kit (Qiagen) ... the manuscript All authors read and approved the final manuscript Acknowledgements This work was supported by grants from the Canadian Institutes of Health Research (CIHR), and Merck Canada Inc ... mutation, or wild-type integrase in the presence of μM raltegravir, displayed measurable integration, i.e the signal discernable from unintegrated cDNA was greater than that for the Alu-HIV amplification...

Ngày tải lên: 12/08/2014, 23:23

... activation; whereas the AxxA variant Nef (Pro76Ala and Pro79Ala) did not Page of show substantial activation (Figure 2B) The 85F variant Nef did not affect Hck activation, whereas the Hck activation ... CA) and phycoerythrin-Cy7-conjugated anti-human CCR5 mAb (BD Biosciences) followed by intracellular staining with antibody against p24 Gag In flow cytometric analysis, cells negative for 7-AAD and ... functional constraints in viral replication in this study, we did not find any beneficial Page of effects on clinical parameters (such as CD4 count and viral load) in HIV-infected patients with HLA-B*35...

Ngày tải lên: 13/08/2014, 01:21

... sense,5'-GCTGTTTGTATGGAAAATGGC-3' and antisense: 5'CCGCTGCCTTCATTAGAAAG-3', TRF2 sense, 5'-GACCTTCCAGCAGAAGATGC-3' and antisense, 5'-GTTGGAGGATTCCGTAGCTG-3' The thermal cycling conditions consisted ... Gonzalez-Suarez E, Samper E, Ramirez A, Flores JM, Martin-Caballero J, Jorcano JL, Blasco MA: Increased epidermal tumors and increased skin wound healing in transgenic mice overexpressing the catalytic ... 5'-TGTTTGGAGACTGTGTACAAGGCG-3', hTERT sense, 5'-TGTTTCTGGATTTGCAGGTG-3' and antisense, 5'-GTTCTTGGCTTTCAGGATGG-3', Pot1 sense, 5'TGGGTATTGTACCCCTCCAA-3' and antisense, 5'-GATGAAGCATTCCAACCACGG-3'...

Ngày tải lên: 13/08/2014, 09:21

... CATATCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAGGAGACGGTGGAGAAGGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG M74949 CCCATATCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAGGAGACGGTGGAGAAAGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG M74945 CCCATATCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAGGAGACGGTGGAGAAAGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG ... CCCATATCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAGGAGACGGTGGAGAAAGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG M74948 CCCATATCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAGGAGACGGTGGAGAAAGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG M75142 CCCATATCCAACAGGACCCAGCACTGCCAACCAGAGAAGGCAAAGAAGGAGACGGTGGAGAAGGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG ... CCCATATCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAAGAGACGGTGGAGAAGGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG L22812 CCCATATCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAAGAGACGGTGGAGAAGGCGGTGGCAACAGCTCCTGGCCTTGGCAGATAG...

Ngày tải lên: 13/08/2014, 09:21

... can produce a pitch contour automatically from a wave data file with high accuracy, then save the contour to a database index file as described in table II Fig.7 Waiting for speech commands from ... synthesis a little difference than in other languages Following are some particular traits needed to consider in a Vietnamese TTS system: Vietnamese is a monosyllable and tonal language, there are ... speech In order to speed the creation of database, we have built a database tool supporting auto frame detecting This is a very useful tool for creating the database with less effort This tool can...

Ngày tải lên: 12/04/2013, 16:05

... expressing HFEWT–HA, HFE-NN110/130AA–HA, HFE-NN130/234AA–HA or HFENN234/110AA–HA protein were incubated for 16 h in the presence or absence of mM tunicamycin as indicated (Tunica) HA-tagged proteins ... mutagenesis The HFE NN110/ 130AA mutant was made by introducing the N13 0A mutation into the pEP7–HFE-N11 0A HA plasmid The HFE NN130/234AA mutant was made by introducing the N23 4A mutation into ... of a single glycosylation site that is of such absolute importance that it is capable in its own right of regulating localization, b2M interactions or transferrin binding Instead, we observed a...

Ngày tải lên: 06/03/2014, 22:21

... specificity (anti-PKAacat, anti-PKAbcat and anti-PKAccat; catalogue numbers sc903, sc904, sc905; Santa Cruz Biotechnology, Santa Cruz, CA, USA); a monoclonal anti-C antibody (anti-Cmono; catalogue ... shown in Fig 1B, three commercially available polyclonal antibodies (anti-PKAacat, antiPKAbcat and anti-PKAccat) and one monoclonal A T-cell Jurkat NT2 antibody (anti-Cmono) were immunoreactive ... RIa and RIIa to form PKAI and PKAII in T cells (A) Confocal laser immunofluorescence of human T cells using anti-Cb2(SNO103) in combination with anti-RIa and anti-RIIa Human T cells were incubated...

Ngày tải lên: 16/03/2014, 18:20

... Ca2+-pump CaM-binding domain to only the C-terminal lobe of CaM demonstrates that Ôwrapping aroundÕ a CaM binding domain, as seen in the complexes with MLCK and CaMKIIa, is not necessary to activate ... activate certain CaMregulated proteins Ca2+/CaM dependent serine/threonine kinase which phosphorylates CaM-dependent kinases I and IV, modulating a signal transduction cascade leading to Ca2+-regulated ... change and enables Ca2+/CaM to bind to specific CaM-binding domains The binding of Ca2+/CaM to its target proteins alters their activity in a calcium dependent manner The details of the actual...

Ngày tải lên: 17/03/2014, 09:20

... CCTGATTTCCCCGAAATGACGGA-3¢) and IL-2Ra GAS-c/GAS-n (5¢-TTTCTTCTAGGAAGTACCAAA CATTTCTGATAATAGAA-3¢) The probes were 32 P-labelled by T4 polynucleotide kinase and the binding reaction was performed at room ... Minami, Y., Nakagawa, Y., Kawahara, A. , Miyazaki, T., Sada, K., Yamamura, H & Taniguchi, T (1995) Protein tyrosine kinase Syk is associated with and activated by the IL-2 receptor: possible link ... prepared and incubated for one hour with Stat1, Stat3, Stat4 and Stat5 antibodies, followed by binding to a P32 IL-2Ra GAS-c/GAS-n labelled GAS element DNA binding activity was analysed by EMSA...

Ngày tải lên: 31/03/2014, 15:20