a new technique for recording joint sounds

... radiation and ambient temperature measured by solar radiation and meteorological station located at National Research Institute of Astronomy and Geophysics Helwan, Cairo, Egypt, located at latitude ... parallel optimization algorithms that use a performance criterion for evaluation and a population of possible solutions to the search for a global optimum GA is capable of handling complex and ... À0.1354420 A comparison between GA and ABC optimal cost @ Helwan city Study cases Device type Case Case Case Case Case CS6P-200 Ropt Study cases Case Case Case Case Case Case Case Case 405 Genetic algorithm

Ngày tải lên: 13/01/2020, 12:03

... Linguistics. Canasai Kruengkrai, Kiyotaka Uchimoto, Jun’ichi Kazama, Yiou Wang, Kentaro Torisawa, and Hitoshi Isahara. 2009. An error-driven word-character hybrid model for joint Chinese word segmentation ... HLT-NAACL 2004: Main Proceedings, pages 249–256, Boston, Massachusetts, USA, May 2 - May 7. Association for Computational Linguistics. Mengqiu Wang, Kenji Sagae, and Teruko Mitamura. 2006. A fast, ... Language Processing, pages 133–143, Sapporo, Japan, July. Association for Computational Linguis- tics. Richard Sproat, William Gale, Chilin Shih, and Nancy Chang. 1996. A stochastic finite-state

Ngày tải lên: 17/03/2014, 00:20

... the rate constants k A 0 and k B 0 .In fact, the catalytic proton enhances the rate dramatically both in the separated a and b chains, by a factor of more than 10 6 per mole for state A and state ... experimental data with the aid of a computer. As a result, the pH-dependence curves for the autoxidation rate of the separated a and b chains have been analysed completely in terms of an Ôacid-catalysed ... probable explanations are as follows. At basic pH, the separated a and b chains are both quite susceptible to autoxidation. Each haem pocket seems to be consid- erably open to allow easier attack

Ngày tải lên: 17/03/2014, 10:20

... 43 Critical Organizational Attributes 45 Structural and Procedural Features and Analysis of Organizational Models 50 Discriminating Among Organizational Models 62 CHAPTER FIVE Designing a New Management ... streams and annual appropriations NASA (an IGA) receives annual appropriations In the case of annual appropriations, the Senate and House will be required to authorize and appropriate ... IGA GOVCORP Define other organizational features Board... the NRC (an IGA) has a dedicated funding stream but is subject to an annual appropriation, and Amtrak (a GOVCORP) has both dedicated

Ngày tải lên: 23/03/2014, 00:20

... William D An Anatomy of Risk Malabar,... evaluation, and adjustment 9 What Risk Management Adds to Project Management Risk management looks ahead in the project and adds a structured approach ... Team Risk Management function and describes a typical activity... identifying and managing risk) Integrated management • Making risk management an integral and vital part of project management ... context of a number of different disciplines in an article for Risk Analysis: What is risk management? To many social analysts, politicians, and academics it is the management of environmental and nuclear

Ngày tải lên: 23/03/2014, 23:21

... (Ed.), Natural language processing New York: Algorithmics Woods, W A (1980) Cascaded ATN grammars American Journal of Computational Linguistics 1, 1-12 Woods, W A (1984) Natural language communication ... of natural language and vision, Seattle, WA O Nuallain, S., & Smith, A (1994) An investigation into the common semantics of language and vision Paper presented at the AAAI spring symposium, March ... Strategies in NLP Hillsdale, NJ: Erlbaum 271 The Search for Mind Smith, A. , B Farley and Ó Nualláin, S (1996) Visualization of natural language In Gretal (Ed.) Natural Language Processing and

Ngày tải lên: 03/04/2014, 12:07

... in a geographically compact area Naturally, the geographical area included varies inversely with the population density We computed distances among the centroids of each block group as measured ... Bromhead and D Lowe, “Multivariable functional interpolation and adaptive networks , Complex Systems, vol 2, 1988, pp 321-355 6 J.Park and I.W Sandberg “Approximation and. .. IEEE Transactions ... APPOROXIMATLY PROBLEM WITH WHITE NOISE DATA With training in equally spaced nodes, the HDH-1 phase can be apply in many applications which needs fast training time such as in computer graphics, pattern

Ngày tải lên: 12/04/2014, 15:40

... Leaf Rust* DAGMAR S. RovERATn*'% ANA REGINA R. TEIXEIRA and WALKYRIA B. C. MORAES Authors' address: Se^ao de Bioquimica Fitopatologica, Instituto Biologico, CP. 7119, 0105! Sao Paulo, ... 5 semanas. A prote9ao observada foi sistemica. O indice de prote^ao foi determinado peia redugao do numerc medio de lesoes por folha. Uma redu^ao no tamanho das lesoes nas folhas tratadas, bem ... induced leaf (Table 3). The systemic effect also spread laterally from one leaf of the pair to the other leaf of the same pair (Table 3), and in the same leaf from the adaxial to the abaxial surface

Ngày tải lên: 05/05/2014, 08:45

... 18 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... extension to n-ary classification systems (e.g dim, intermediate, bright) is possible After derivation of frequencies for all sets, data was loaded into a relational database (MySQL) and analyzed with ... The Average CV (CV computed for each patient, then all patients averaged) is shown for each phenotype All Average CV values are less than 16%, suggesting stable expression over time for each

Ngày tải lên: 18/06/2014, 16:20

... CCTGTTTACGGTTTCcartggagrcayttygg GGCAATGTTAAAAGGAACTccnarncccatrtc DNA polymerase TS gene NA7 NA NA NA + + CCACCGTCCCAGACCAACGAAAGCGCCAGA GTCTGCCTGGAATCCCGTGGATATACCAAA CODEHOP, consensus-degenerate ... (IHV, HHV6,7) All HV (IHV) All HV - + + - GTGTTCGACttygcnagyytntaycc ACGTGCAACGCGGTGtayggnktnacngg CGGCATGCGACAAACACGGAGTCngtrtcnccrta αHV γHV (IHV, βHV) (CMV) + CCAAGTATCathcargcncayaa All HV (CMV, ... Sequence(degenerate codons are in lower case)3 -6 - + + + - Gayttygcnagyytntaycc TCCTGGACAAGCAGcarnysgcnmtnaa TGTAACTCGGTGtayggnttyacnggngt CACAGAGTCCGTrtcnccrtadat GTCTTGCTCACCAGntcnacnccytt All HV (IHV,

Ngày tải lên: 18/06/2014, 22:20

... goal was to develop and validate a scale that could be administered to anticoagulation patients generally; that is, across indication for anticoagulation and across models of anticoagulation management ... ingela.wiklund@astrazeneca.com; Ewa Hedner - ewa.hedner@astrazeneca.com; Gail Wygant - gail.wygant@astrazeneca.com; Ole Hauch - ole.hauch@astrazeneca.com; Cheryl Beadle Marple - cheryl.marple@astrazeneca.com; ... internal consistency (Cronbach's alpha), scale structure (factor analysis), and correlations between the DASS and demographic variables, clinical characteristics, and scores on the above scales A

Ngày tải lên: 20/06/2014, 15:20

... that can be used by HCCA: t AP STA A Poll TA DA NO Poll t + tPOLL + tNO DELAY + 2tPROP DELAY t AP STA A (i) Polling a Station That Has No Packets for Transmission (Figure 1 (a) ) The AP polls a ... traffic load is represented in Figure 10 It can be seen that regarding MP traffic, performance degradation starts at significantly lower load in POAP than in AWPP HCCA exhibits a steady behavior to a limited ... polls a station and the latter responds that it has no packets for transmission (ii) Polling a Station That Has Packets for Transmission (Figure 1(b)) The AP polls a station and the latter replies

Ngày tải lên: 21/06/2014, 05:20

... Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters Cheng-Han Chan, 1 Soo-Chang Pei (EURASIP Member), 2 and Jong-Jy Shyu 3 1 Department of Aviation and Communication ... it has been shown that the performance in group delay and phase for the proposed systems can be improved drastically by appropriately specifying the range of fractional delay. For the computational ... Introduction For the past decade, the design of variable fractional-delay (VFD) digital filters became an important topic in digital signal processing due to their wide applications in signal processing and

Ngày tải lên: 21/06/2014, 07:20

... 1984 25 P N Anh and L D Muu, “Coupling the Banach contraction mapping principle and the proximal point algorithm for solving monotone variational inequalities,” Acta Mathematica Vietnamica, vol 29, ... methods for monotone variational inequalities,” Mathematical Programming, vol 104, no 1, pp 39–68, 2005 19 A Bnouhachem, “An LQP method for pseudomonotone variational inequalities,” Journal of Global ... Inequalities and Applications, vol 2010, Article ID 451916, 10 pages, 2010 23 Y Nesterov, “Dual extrapolation and its applications to solving variational inequalities and related problems,” Mathematical

Ngày tải lên: 21/06/2014, 07:20

... Yokohama, Yokohama, Japan, 2000 16 W Takahashi and Y Ueda, “On Reich’s strong convergence theorems for resolvents of accretive operators,” Journal of Mathematical Analysis and Applications, vol ... C3∗ , and C4 on the results in 10, 20 are dropped A single mapping of the results in is replaced by a finite family of mappings Preliminaries and Lemmas A Banach space E is said to have Gateaux ... of a finite family of accretive operators,” Nonlinear Analysis: Theory, Methods & Applications, vol 70, no 6, pp 2344–2351, 2009 S Kamimura and W Takahashi, “Approximating solutions of maximal

Ngày tải lên: 21/06/2014, 20:20

... limitations has led to a situation where damage is continuing and has placed many important items at risk This has created an urgent need for a technique that can capture the information in each ... 125–135, 1997 E Prados, F Camilli, and O Faugeras, A unifying and rigorous shape from shading method adapted to realistic data and applications,” Journal of Mathematical Imaging and Vision, vol ... intensity values are normalized to one, and the scale factor, the Gaussian amplitude α, is saved as the attenuation factor for that pixel Then a nonlinear Gaussian fit is performed on the normalized...

Ngày tải lên: 21/06/2014, 20:20

... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...

Ngày tải lên: 31/10/2012, 14:59

... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... a certain prejudice towards certain people or race, try to make an extra effort to love them unconditionally For example, if you are biased against Muslims in general, make an extra effort to...

Ngày tải lên: 15/12/2013, 06:15

... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... this as an input to a separate "playback" application The "playback" is not strictly a playback in the sense that users are still allowed to move about and interact in the virtual world An example ... used for VR applications Currently, all major UNIX workstation vendors have specific platforms targeted to the VR market These workstations usually have a enhanced graphics performance and specific...

Ngày tải lên: 23/01/2014, 07:20

... Upgrade, and Increase Monitoring, Data Analysis and Management; • Plan for and Adapt to Sea Level Rise; and • Identify and Fund Focused Climate Change Impacts and Adaptation Research and Analysis ... changes associated with climate change are already having a significant biological impact across a broad range of natural systems For example, across North America, plants are leafing out and ... the capacity of many organisms to adapt in this classical sense U.S natural resource managers and conservationists are accelerating their plans and actions for climate change adaptation, in large...

Ngày tải lên: 25/01/2014, 20:20