a new source for cell replacement therapy

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

... passive planar air breathing fuel cell cathode J Power Sources 2007, 167(1), 118–129 [3] Rajani B.P.M and Kolar A. K A model for a vertical planar air breathing PEM fuel cell J Power Sources 2007, ... can be seen that for a high nominal current density, a high fraction of the current is generated at the catalyst layer near the air inlet area, leading to under-utilization of the catalyst at ... Catalyst layers The catalyst layer is treated as a thin interface, where sink and source terms for the reactants are implemented Due to the infinitesimal thickness, the source terms are actually...

Ngày tải lên: 05/09/2013, 14:58

18 549 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... subcutaneously with PMPA, 20 mg/kg/day, and FTC, 50 mg/kg/day Quantitative assay for SIVmac251 viral RNA levels For measurement of plasma SIVmac251 RNA levels, a quantitative TaqMan RNA reverse transcription-PCR...

Ngày tải lên: 12/08/2014, 23:23

19 317 0
Báo cáo sinh học: "Immediate transfection of patient-derived leukemia: a novel source for generating cell-based vaccines" ppt

Báo cáo sinh học: "Immediate transfection of patient-derived leukemia: a novel source for generating cell-based vaccines" ppt

... significant bone marrow involvement For example, the large amount of tumor material typically available from leukemia patients makes these cells accessible for autologous patient-derived vaccine ... used for nuclear DNA isolation Prior to DNA isolation, nuclei were washed in PBS and incubated with 0.5U DNase I (Ambion, Austin, TX) at 37° for 10 and washed again twice in PBS Nuclear DNA was ... 106 cells and the black bars represent neo amplification from non-nucleofected U2OS cells Nuclear DNA was harvested and amplified from separate samples, error bars indicate the standard deviation...

Ngày tải lên: 14/08/2014, 19:22

13 256 0
Reactive oxygen species mediated regulation of the na+ h+ exchanger, NHE 1 gene expression a new mechanism for tumor cells resistance to apoptotic cell death

Reactive oxygen species mediated regulation of the na+ h+ exchanger, NHE 1 gene expression a new mechanism for tumor cells resistance to apoptotic cell death

... Human Malignant Melanoma DMEM Hygromycin M14 RacV12 Human Malignant Melanoma DMEM Hygromycin U87 Human Malignant Glioblastoma RPMI - LNCaP Human Malignant Prostate Cancer RPMI - Table Various Cell ... dependent (Fadeel B and Kagan VE, 2003) Fas receptor activation is a major trigger for apoptosis, and it has been shown that O2.can act as a natural inhibitor of Fas-induced cell death in tumor cells ... diffusion across the cell membrane, carbonic anhydrase activity, and last but not the least transport of acid/base equivalents across cell membrane via specialized transporters In fact many cells face...

Ngày tải lên: 16/09/2015, 08:31

155 399 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...

Ngày tải lên: 31/10/2012, 14:59

11 716 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... [19] Kumar A. , Rao N.N., Kaul S.N Alkali-treated straw and insoluble straw xanthate as low cost adsorbents for heavy metal removal – preparation, characterization and application Biores Technol 2000, ... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release...

Ngày tải lên: 05/09/2013, 15:28

20 437 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... a certain prejudice towards certain people or race, try to make an extra effort to love them unconditionally For example, if you are biased against Muslims in general, make an extra effort to...

Ngày tải lên: 15/12/2013, 06:15

59 771 3
A new algorithm for enumeration of minimum cutsets of graph by branch addition

A new algorithm for enumeration of minimum cutsets of graph by branch addition

... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... node are shown in Table The calculations have made by Matlab version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied to a part of Iran transmission and ... Enumeration of Minimal Cutsets Separating Vertices in a Class of Undirected Planar Graphs," IEEE Trans on Reliability, Vol 41, No 1, March 1992 Li Yan, Hamdy A Taha, Thomas L Landers, "A Recursive...

Ngày tải lên: 03/01/2014, 19:35

6 545 0
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... this as an input to a separate "playback" application The "playback" is not strictly a playback in the sense that users are still allowed to move about and interact in the virtual world An example ... used for VR applications Currently, all major UNIX workstation vendors have specific platforms targeted to the VR market These workstations usually have a enhanced graphics performance and specific...

Ngày tải lên: 23/01/2014, 07:20

10 634 1
Tài liệu A New Era for Conservation docx

Tài liệu A New Era for Conservation docx

... Upgrade, and Increase Monitoring, Data Analysis and Management; • Plan for and Adapt to Sea Level Rise; and • Identify and Fund Focused Climate Change Impacts and Adaptation Research and Analysis ... changes associated with climate change are already having a significant biological impact across a broad range of natural systems For example, across North America, plants are leafing out and ... the capacity of many organisms to adapt in this classical sense U.S natural resource managers and conservationists are accelerating their plans and actions for climate change adaptation, in large...

Ngày tải lên: 25/01/2014, 20:20

69 440 0
Tài liệu Dollar Cost Banding - A New Algorithm for Computing Inventory Levels for Army Supply Support Activities pdf

Tài liệu Dollar Cost Banding - A New Algorithm for Computing Inventory Levels for Army Supply Support Activities pdf

... Command ASB Aviation Support Battalion ASL Authorized Stockage List AVIM Aviation Intermediate Maintenance AVN Aviation AWCF Army Working Capital Fund CASCOM Combined Army Support Command CTASC Corps/Theater ... MR-1150 -A, 2002; Marygail K Brauner et al., Dollars and Sense: A Process Improvement Approach to Logistics Financial Management, Santa Monica, CA: RAND Corporation, MR-1131 -A, 2000; and Marygail ... parts that are unavailable at the SSA might not arrive for a week or more But despite the advantages of having parts available from the supporting SSA, Army inventory managers determining what to...

Ngày tải lên: 17/02/2014, 17:20

132 426 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Tài liệu A New Paradigm for Economic Development docx

Tài liệu A New Paradigm for Economic Development docx

... academic patents awarded to academic researchers in each state, relative to the number of science and engineering doctorate holders in academia California, Massachusetts, Florida, Maryland, and ... Research Triangle Park The idea for a research park in the Raleigh-Durham-Chapel Hill area began in the 1950s, spawned by a disparate cast of characters that included bankers, professors, real ... Utah Iowa North Carolina Alaska 10 Alabama Based on state and local spending per capita on higher education For details see Table 10 Rockefeller Institute Page 47 www.rockinst.org Higher Education...

Ngày tải lên: 20/02/2014, 19:20

74 410 0
A New Vision for Adolescent Sexual and Reproductive Health pot

A New Vision for Adolescent Sexual and Reproductive Health pot

... sexual behavior, use of contraception, and use of abortion An important reason that European youth have better sexual health outcomes is that adults approach teenage sexuality differently than adults ... adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... European levels without fundamental changes in adult social in adult social norms norms regarding access to health information and to reproductive regarding access to health services health information...

Ngày tải lên: 05/03/2014, 17:20

7 662 0
A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

... (such as smoking cessation) are achieved Foundations could act as payor via performance-based grants on projects that have large societal value, but that produce outcomes that are hard to measure ... Collaboration with relevant government agencies will also be necessary to gain access to administrative data, such as Medicaid records Administrative data will allow evaluators to assess program ... risks, as well as financial and social returns, are properly articulated and managed They will require tools, such as a credit scorecard, that reflect an intermediary’s methodical and careful...

Ngày tải lên: 06/03/2014, 08:20

36 262 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... cathepsin D activity J Pept Sci 11, 166–174 31 Yasuda Y, Kageyama T, Akamine A, Shibata M, Kominami E, Uchiyama Y & Yamamoto K (1999) Characterization of new fluorogenic substrates for the rapid and sensitive ... Hayakumo T & Nakajima M (1996) Expression of cathepsin E in pancreas: a possible tumor marker for pancreas, a preliminary report Int J Cancer 67, 492–497 22 Uno K, Azuma T, Nakajima M, Yasuda...

Ngày tải lên: 07/03/2014, 09:20

12 645 0
Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

... 2: Example of a simple grammar lattice All grammars generate a common lexicon for all the grammars) A Grammar Lattice as a Search Space for Grammar Induction a Rule generalization steps a c s ... constraint-based grammars for natural language specifically designed to enable learning from representative examples annotated with semantics We have presented a new grammar learning model and showed ... representative examples associated with a LWFG conformal w.r.t a sublanguage , and as then can always be learned from ) the grammar lattice top element ( Based on the theoretical foundation of...

Ngày tải lên: 08/03/2014, 02:21

8 402 0
A New Formula for Child Health: Doctors Communities + Healthy Kids pdf

A New Formula for Child Health: Doctors Communities + Healthy Kids pdf

... booth and other health and safety games and arts booths Another parent was in charge of sharing information about the health fair at Café el Director, a monthly bilingual L to R: Juanita (with granddaughter ... local radio station 1430AM and operates the Diaspora Newspaper in the Greater Sacramento region The only group of its kind in the area, Afisha is a major source of news and information for the ... before her, identified the Russian/English language barrier as a huge challenge for health and healthcare Instead, for the first time, Dr Inessa recognized that her native language was an asset...

Ngày tải lên: 14/03/2014, 09:20

94 252 0
Case handling: a new paradigm for business process support pot

Case handling: a new paradigm for business process support pot

... free A1 A2 D4 A3 mandatory Skip mandatory R2 mandatory restricted mandatory D1 D2 D3 Fig Abstract example introducing the schema level of the case handling meta model mandatory for A1 , A2 and A3 ... definitions As indicated above, D1 is mandatory for A1 , A2 and A3 , D2 is mandatory for A2 , while D3 is restricted for A3 D0 and D4 are free data elements, which appear in form definition F3, associated ... each activity with which they are associated There are activities without forms to cater for automatic activities, for example automated queries to external database systems Fig assumes that at...

Ngày tải lên: 15/03/2014, 21:20

34 524 0
Food and health in Europe: a new basis for action pdf

Food and health in Europe: a new basis for action pdf

... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark ... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... information and data so that they can make informed decisions to prevent harm Nationally collected data can be compared with international norms and standards to ensure that public health is at...

Ngày tải lên: 16/03/2014, 14:20

38 334 0
w