a new perspective for labeling the carbon footprint against climate change

... of the induced leaf (Table 3) The systemic effect also spread laterally from one leaf of the pair to the other leaf of the same pair (Table 3), and in the same leaf from the adaxial to the abaxial ... cotton and sprayed on the abaxial (under) leaf surface with 152 DAGMAR S ROVERATTl, ANA REGINA R TEIXEIRA and WALKYRIA B C MORAES the inducer preparation, using nitrogen as the propellent gas, at ... third and fourth pairs of leaves at 72 h before inoculation of the pathogen onto the abaxial surface of the same treated leaves; (4) groups of 15 plants each had one leaf" of the third pair treated...

Ngày tải lên: 05/05/2014, 08:45

... than the synthetic oscillatory signal Assume that the reference respiration signal x(n) has a main spectral peak fx , and the original signal is y(n) with a spectral peak f y The main spectral ... and the number of samples of the data; (4) perform inverse wavelet transformation to obtain the heartbeat signal EXPERIMENTS AND ANALYSIS There are 15 healthy volunteers who participated in the ... generated by the oscillator via a directional coupler Then it is radiated by the antenna via a circulator The oscillator operates at 10.525 GHz, and the transmission power is 30 mW Hence GaAs Gunn...

Ngày tải lên: 22/06/2014, 23:20

... outperforms the AIC and MDL criteria in terms of detection rate (Figure 5a) Figures 5b and 5c illustrate the mean estimate and variance variations They indicate a very interesting behavior of the new ... should capture in a suitable way the jump from the last eigenvalue associated to the signal subspace and the first eigenvalue associated to the noise subspace As it was stated above, it is difficult ... Ideal shapes of (a) the discriminant functions and (b) the associated cost function, for N = estimate, the eigenvalue variation can be still used, in a different form, for obtaining N The main...

Ngày tải lên: 23/06/2014, 01:20

... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... to change for the better We can always change for personal and spiritual growth Here are a few areas we can change: Our attitude Our beliefs Our habits and tendencies in thoughts, words and actions ... what they visualised in their lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By...

Ngày tải lên: 15/12/2013, 06:15

... the input component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a ... the lack of software that exploits the advantages of this new generation of devices Thus, the user interface for CAD programs has remained essentially the mouse/keyboard/menu paradigm The availability ... orientation tracking of a user's head and/or hand These data are then used to update the virtual world scene The tracker is sometimes also used to track the user's hand position (usually wearing a...

Ngày tải lên: 23/01/2014, 07:20

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... the wild-type SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

... Innovative applications of artificial intelligence, AAAI’97/IAAI’97, pages 598–603 AAAI Press Michael Collins and Terry Koo 2005 Discriminative reranking for natural language parsing Computational ... to adapt the part-of-speech tags to facilitate this modeling strategy For example, the tag for nouns is NN as in 憞䠮䞎 ‘Iraq’ and 卣敯埚 ‘former president’ After annotation, the former is flat, but the ... some applications such as information extraction, the former segmentation is adequate, while for others like machine translation, the later finer-grained output is more preferable If the analyzer...

Ngày tải lên: 17/03/2014, 00:20

... dictate demand for paper rolls, with an increase in 67 manufacturing output being favorable for paper manufacturers The state of downstream demand causes significant shifts at each stage of the ... Consultant The #1 tool of a consultant is to understand how a company changes There are dozens of growth and change models that detail how a company receives recommendations from consultants and changes ... Booshoot's leadership wants to expand the company and they know they need change in order to accomplish the change needed My challenge was in reframing their expectations of what that change would...

Ngày tải lên: 18/03/2014, 02:20

... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by the number of colonies retaining the target gene divided by that of total ... terminator) from pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the...

Ngày tải lên: 22/03/2014, 21:20

... 168 Sakamoto A, Iwabata K, Koshiyama A, Sugawara H, Yanai T, Kanai Y, Takeuchi R, Daikuhara Y, Takakusagi Y & Sakaguchi K (2007) Two X family DNA FEBS Journal 276 (2009) 943–963 ª 2009 The Authors ... and atrpa70b mutant indicated very little AtRPA70b [12] These results indicated that AtRPA7 0a (probably, the AtRPA7 0a AtRPA32-2–AtRPA14 complex) has an essential role, probably in DNA replication ... AtRPA70b is involved in the repair system for DNA damaged by these mutagens [11,12] The lethality of both the T-DNA insertion mutant and the RNAi line of AtRPA7 0a indicate that the AtRPA7 0a AtRPA32-2–AtRPA14...

Ngày tải lên: 23/03/2014, 06:20

... how many Forms are there? Is there a Form for a CS text? We see this issue again in AI The materialist/dualist war (it has all the characteristics thereof) is essentially part of Plato’s heritage ... necessarily part of the intersubjective domain as expanded on in chapter The meanings they carry are therefore potentially shareable How then they get their names? In the same way as “dog” and ... what is known as the semantical problem: how our names for these “private” mental states get their meaning? Related to this is the problem of how we can say that humans have mental states at all...

Ngày tải lên: 03/04/2014, 12:07

... collaborate with the industry as their research programs mature QSTP facilitates the engagement of the private sector with the universities, as a base for multi-national and national companies ... include: Australia, Bangladesh, Yemen (3 each); Republic of Korea (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, ... are many research opportunities available to the students and faculty at WCMC- Q An example of such opportunities is the availability of research funds through the Qatar Foundation’s Qatar National...

Ngày tải lên: 18/06/2014, 19:20

... collaborate with the industry as their research programs mature QSTP facilitates the engagement of the private sector with the universities, as a base for multi-national and national companies ... include: Australia, Bangladesh, Yemen (3 each); Republic of Korea (South), Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, ... are many research opportunities available to the students and faculty at WCMC- Q An example of such opportunities is the availability of research funds through the Qatar Foundation’s Qatar National...

Ngày tải lên: 20/06/2014, 03:20

... proposed alternative paradigm The current common paradigm is characterized by separate and distinct programs with little coordination or overlap The alternate paradigm emphasizes the need for increased ... Several individual projects assessing the feasibility of various collaborative and integrative efforts at the healthcare delivery level in urban and rural areas have been carried out or are ongoing ... programs.[18] National-level examples such as these can serve as models that other countries can adopt and implement Page of (page number not for citation purposes) Journal of the International AIDS...

Ngày tải lên: 20/06/2014, 08:20

... An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur–Ulam problem Choonkil Park1 and Cihangir Alaca∗2 Department of Mathematics, Research Institute for Natural ... Misiak [3], a Kim and Cho [4], and Malˇeski [5] developed the theory of n-normed c space In [6], Gunawan and Mashadi gave a simple way to derive an (n−1)-norm from the n-norms and realized that any ... Bag and Samanta [8] and also gave some fundamental properties of this space In 1932, Mazur and Ulam [11] proved the following theorem Mazur–Ulam Theorem Every isometry of a real normed linear...

Ngày tải lên: 20/06/2014, 21:20

... has created an urgent need for a technique that can capture the information in each of the negatives of a large collection before the damage causes a complete and irretrievable loss of information ... for each one (Figure 5) For each pixel, the intensity values are normalized to one, and the scale factor, the Gaussian amplitude α, is saved as the attenuation factor for that pixel Then a nonlinear ... vertical Gaussian stripes The initial pass is captured with only the display device in the scene to acquire a base case for the Gaussian parameters σ and X0 The next pass of the stripes is captured...

Ngày tải lên: 21/06/2014, 20:20

... industry Additional results are available at www.relationshipera.com, and details of the Brand Sustainability Map research methodology are available at www.relationshipera.com/brand-sustainability/bsm-info/ ... brand relationship surveys and, from the data we gathered, placed actual brand relationships onto the Brand Sustainability Map To date, the research has focused on the two to three market share ... series, and Saatchi’s Lovemarks, the trust and transactions model described here illuminates the brand-person relationship in a new way More importantly, the model is matched by an actionable approach...

Ngày tải lên: 27/06/2014, 23:20

... 3-clusters that are paired with each other Either C1 and C2 have at most nearby threatened 1-clusters and threatened 3-clusters, or they have exactly such nearby clusters, but they also have a nearby ... 3-clusters that are paired with each other Clusters C1 and C2 have at most nearby threatened 1-clusters and threatened 3-clusters If they have exactly such nearby clusters, then they also have a nearby ... between our claims and our structural lemmas is that the claims are statements about our discharging rules, whereas the lemmas are statements about any 1-ID code in the infinite hexagonal grid So...

Ngày tải lên: 08/08/2014, 01:20

... graphs, and showed that the reciprocals of zeta functions of regular graphs are explicit polynomials A zeta function of a regular graph G associated with a unitary representation of the fundamental ... fundamental group of G was developed by Sunada [11,12] Hashimoto [4] treated multivariable zeta functions of bipartite graphs Bass [2] generalized Ihara’s result on the zeta function of a regular graph ... identity by using a linear algebraic method Stark and Terras [9] gave an elementary proof of this formula, and discussed three different zeta functions of any graph Various proofs of Bass’ Theorem were...

Ngày tải lên: 08/08/2014, 01:20

... significant features of laccase in Rhus species The brown deposit in the sections indicates the localization of active laccase in situ Activity of laccase is also stimulated by its natural substrate ... laccase catalysis is mainly distributed in the canals and their sheath cells, epithelial cells and the ducts with latex droplets In the control section, almost no deposit can be seen in the canals ... the present paper may be used to bridge these gaps In the lacquer tree, laccase may play a role in sealing-off damaged tissue It could also be involved in a defense mechanism against pathogens by...

Ngày tải lên: 09/08/2014, 03:24