... Brill and Moore (2000) proposed employing a generative model for candidate generation and a hierarchy of trie struc- tures for fast candidate retrieval. Our approach is a discriminative approach and ... Human Language Tech- nology and Empirical Methods in Natural Language Processing, HLT ’05, pages 955–962, Morristown, NJ, USA. Association for Computational Linguistics. Alfred V. Aho and Margaret ... Empirical Methods in Natural Language Process- ing and Computational Natural Language Learning, pages 181–189. Andrew R. Golding and Dan Roth. 1999. A winnow- based approach to context-sensitive...
Ngày tải lên: 30/03/2014, 21:20
... Essay Assessor (IEA) (Landauer et al., 2003) uses Latent Semantic Analysis (LSA) (Lan- dauer and Foltz, 1998) to compute the semantic sim- ilarity between texts, at a specific grade point, and a ... Semantic Analysis (LSA) (Landauer et al., 2003), generative machine learning models (Rudner and Liang, 2002), domain-specific feature extraction (Attali and Burstein, 2006), and/ or modified syntac- tic ... Discovery and Data Mining (KDD), pages 133–142. ACM. T.K. Landauer and P.W. Foltz. 1998. An introduction to latent semantic analysis. Discourse processes, pages 259–284. T.K. Landauer, D. Laham, and...
Ngày tải lên: 20/02/2014, 04:20
Báo cáo y học: "IA simple, fast, and accurate method of phylogenomic inference" docx
... 5. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 Alphaproteobacteria Betaproteobacteria Gammaproteobacteria Deltaproteobacteria Epsilonproteobacteria Unclassified proteobacteria Bacteroidetes Chlamydiae Cyanobacteria Acidobacteria Thermotogae Fusobacteria Actinobacteria Aquificae Planctomycetes Spirochaetes Firmicutes Chloroflexi Chlorobi Unclassified ... developed the method, and per- formed the analyses. JAE advised on method design and test- ing. MW and JAE wrote the paper. Additional data files The following additional data are available with ... susceptible to data sampling bias than a similarity based approach, and it makes Major phylotypes identified in Sargasso Sea metagenomic dataFigure 3 Major phylotypes identified in Sargasso Sea metagenomic...
Ngày tải lên: 14/08/2014, 21:20
Báo cáo khoa học: "Fast and accurate query-based multi-document summarization" docx
... Computational Linguistics FastSum: Fast and accurate query-based multi-document summarization Frank Schilder and Ravikumar Kondadadi Research & Development Thomson Corp. 610 Opperman Drive, Eagan, ... 2007), pages 757–766, Banff, Canada. B. Efron, T. Hastie, I.M. Johnstone, and R. Tibshirani. 2004. Least angle regression. Annals of Statistics, 32(2):407–499. S. Gupta, A. Nenkova, and D. Jurafsky. ... 2004. Rouge: a package for automatic evaluation of summaries. In Proceedings of the Workshop on Text Summarization Branches Out (WAS 2004). A. Nenkova and L. Vanderwende. 2005. The impact of frequency...
Ngày tải lên: 17/03/2014, 02:20
báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx
... research and rehabilitation. Assist Technol 2004, 16:54-62. 6. Sherman W, Craig A: Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002. 7. Stanney ... under what circumstances a computer generated environment should be considered virtual reality? Factors that differ among many of the lab- oratories claiming to use virtual reality and that also emerge ... this month. Viau et al. com- pare the kinematic strategies of reach, grasp, and place movements performed with physical and virtual objects by healthy adults and those with hemiparesis. Sveistrup presents...
Ngày tải lên: 19/06/2014, 10:20
Báo cáo hóa học: " Heavily glycosylated, highly fit SIVMne variants continue to diversify and undergo selection after transmission to a new host and they elicit early antibody dependent cellular responses but delayed neutralizing antibody responses" pdf
... Wang S, Hui H, Kappes JC, Wu X, Salazar- Gonzalez JF, Salazar MG, Kilby JM, Saag MS, Komarova NL, Nowak MA, Hahn BH, Kwong PD, Shaw GM: Antibody neutralization and escape by HIV-1. Nature 2003, 422(6929):307-312. 15. ... infecting variant (data not shown). For animals infected with the early variant, there was no length variation at 40 weeks and little length vari- ation at ~75 weeks (7% in one animal). Some animals infected ... intermediate and late variants also had no length variation, while others demonstrated extensive variation (up to 80% in one animal). Although animals infected with the late variants had more...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific PCR upper primer TGT GCT GCC ATA TCT ACT TCA GAA ACT AC Type-specific ... crystalline phase of superparamag- netic nanoparticles. Table 1 Hybridization probes and type-specific PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary ... imaging, labelling and sensing. Nat Mater 2005, 4:435-446. 16. Ma HL, Qi XR, Maitani Y, Nagai T: Preparation and characterization of superparamagnetic iron oxide nanoparticles stabilized by alginate....
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: " Research Article Fast and Accurate Video PQoS Estimation over Wireless Networks" pot
... for estimating the PQoS index in a fast and easy way. The proposed analytical model has an average pearson correlation coefficient of 0.986, as proof of its robustness and reliability in many network 0.35 0.45 0.55 0.65 0.75 0.85 0.95 1.05 1.15 1.25 1.35 Analytical ... (CCECE ’06), pp. 1846–1849, Ottawa, Canada, May 2006. [36] D. Vassis, G. Kormentzas, A. Rouskas, and I. Maglogiannis, “The IEEE 802.11g standard for high data rate WLANs,” IEEE Network, vol. 19, ... Reisslein, and S. Panchanathan, A framework for advanced video traces: evaluating visual quality for video transmission over lossy networks,” EURASIP Journal on Applied Signal Processing, vol. 2006, Article...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo hóa học: " Fast and Accurate Ground Truth Generation for Skew-Tolerance Evaluation of Page Segmentation Algorithms" potx
... Maryland, USA. His research interests are in ma- chine vision and image analysis. His current research focuses on texture analysis, face image analysis, and machine vision for sens- ing and understanding ... two advantages. Firstly, we know the skew angle and secondly, we exclude the scaling and translation, that is, we avoid a sophisticated, time consuming and not always accurate document registration procedure. 2 In ... have such a shape. This is related to the area of the representative square. For angles be- tween −90 ◦ and 0 ◦ , this area reaches a maximum at extreme values of this range and it is minimal...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo y học: " The influence of psychiatric screening in healthy populations selection: a new study and metaanalysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality traits" ppt
... and rs25531 polymorphisms and anxiety-related personality traits Alessandra Minelli 1 , Cristian Bonvicini 1 , Catia Scassellati 1 , Riccardo Sartori 2 and Massimo Gennarelli 1,3* Abstract Background: ... Gade-Andavolu R, Gonzalez N, Wu S, Muhleman D, Blake H, Mann MB, Dietz G, Saucier G, MacMurray JP: A multivariate analysis of 59 candidate genes in personality traits: the temperament and character inventory. ... the statistical analyses and carried out all genetic analyses; CS participated in the design and coordination of the study and co-wrote the manuscript; RS performed the statistical analyses and...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: " Withdrawal of inhaled corticosteroids in individuals with COPD - a systematic review and comment on trial methodology" ppt
... acceptable le vel of bias for three or more bias criteria (Table 3). The fourth trial appeared to have a much greater potential for bias, was substantiall y different in s ize and design, and had a different ... a meta-analysis on outcome data from trials which we rated as acceptable in terms of bias on at least three of the five bias criteria listed above, and only when relevant data could be obtained ... Explanatory and pragmatic attitudes in therapeutical trials. Journal of Chronic Diseases 1967, 20:637-648. 23. Peto R, Collins R, Gray R: Large-scale randomized evidence: large, simple trials and...
Ngày tải lên: 12/08/2014, 13:22
Báo cáo sinh học: "A new, fast algorithm for detecting protein coevolution using maximum compatible cliques" pptx
... contributions AR developed, designed and programmed the algorithm under the supervision of JR and ERMT. AB prepared the sequence data for analysis, performed the accuracy and speed tests and analyzed ... compare the accuracy and performance of MMMvII to those of the original MMM an evaluation data set comprised of pairs of distance matrices was compiled using the OMA d atabase [16]http://www.omabrowser. com. We ... test of com- patibility within the new match, and is an approximate heuristic designed to be fast rather than exact. The rationale behind designing this algorithm was that a full compatibility test...
Ngày tải lên: 12/08/2014, 17:20
docomo japan s wireless tsunami how one mobile telecom created a new market and became a global fo phần 1 pdf
... cor- porations, professional associations, and other organizations. For details, con- tact Special Sales Department, AMACOM, a division of American Manage- ment Association, 1601 Broadway, New York, ... a New Market and Became a Global Force JOHN BECK AND MITCHELL WADE American Management Association New York ã Atlanta ã Brussels ã Buenos Aires ã Chicago ã London ã Mexico City San Francisco ... us to propose a radical, almost embarrassing idea: In managing your business, human passions matter. A lot. More than any of us admit, and certainly more than we act on. (And we are xii Introduction ...
Ngày tải lên: 14/08/2014, 22:20
docomo japan s wireless tsunami how one mobile telecom created a new market and became a global fo phần 2 pdf
Ngày tải lên: 14/08/2014, 22:20
docomo japan s wireless tsunami how one mobile telecom created a new market and became a global fo phần 3 ppsx
Ngày tải lên: 14/08/2014, 22:20
docomo japan s wireless tsunami how one mobile telecom created a new market and became a global fo phần 4 docx
Ngày tải lên: 14/08/2014, 22:20
docomo japan s wireless tsunami how one mobile telecom created a new market and became a global fo phần 5 doc
Ngày tải lên: 14/08/2014, 22:20
docomo japan s wireless tsunami how one mobile telecom created a new market and became a global fo phần 6 docx
Ngày tải lên: 14/08/2014, 22:21
docomo japan s wireless tsunami how one mobile telecom created a new market and became a global fo phần 7 doc
Ngày tải lên: 14/08/2014, 22:21
docomo japan s wireless tsunami how one mobile telecom created a new market and became a global fo phần 8 docx
Ngày tải lên: 14/08/2014, 22:21