a new fast and accurate grid deformation method
Báo cáo khoa học: "A Fast and Accurate Method for Approximate String Search" pptx
... Brill and Moore(2000) proposed employing a generative model forcandidate generation and a hierarchy of trie struc-tures for fast candidate retrieval. Our approach is a discriminative approach and ... Human Language Tech-nology and Empirical Methods in Natural LanguageProcessing, HLT ’05, pages 955–962, Morristown, NJ,USA. Association for Computational Linguistics.Alfred V. Aho and Margaret ... Empirical Methods in Natural Language Process-ing and Computational Natural Language Learning,pages 181–189.Andrew R. Golding and Dan Roth. 1999. A winnow-based approach to context-sensitive...
- 10
- 507
- 0
Tài liệu Báo cáo khoa học: "A New Dataset and Method for Automatically Grading ESOL Texts" pdf
... Essay Assessor (IEA) (Landauer et al.,2003) uses Latent Semantic Analysis (LSA) (Lan-dauer and Foltz, 1998) to compute the semantic sim-ilarity between texts, at a specific grade point, and a ... Semantic Analysis (LSA) (Landauer et al.,2003), generative machine learning models (Rudner and Liang, 2002), domain-specific feature extraction(Attali and Burstein, 2006), and/ or modified syntac-tic ... Discovery and Data Mining(KDD), pages 133–142. ACM.T.K. Landauer and P.W. Foltz. 1998. An introduction tolatent semantic analysis. Discourse processes, pages259–284.T.K. Landauer, D. Laham, and...
- 10
- 538
- 0
Báo cáo y học: "IA simple, fast, and accurate method of phylogenomic inference" docx
... 5.00.10.20.30.40.50.60.70.8AlphaproteobacteriaBetaproteobacteriaGammaproteobacteriaDeltaproteobacteriaEpsilonproteobacteriaUnclassified proteobacteriaBacteroidetesChlamydiaeCyanobacteriaAcidobacteriaThermotogaeFusobacteriaActinobacteriaAquificaePlanctomycetesSpirochaetesFirmicutesChloroflexiChlorobiUnclassified ... developed the method, and per-formed the analyses. JAE advised on method design and test-ing. MW and JAE wrote the paper.Additional data filesThe following additional data are available with ... susceptible to datasampling bias than a similarity based approach, and it makesMajor phylotypes identified in Sargasso Sea metagenomic dataFigure 3Major phylotypes identified in Sargasso Sea metagenomic...
- 11
- 453
- 0
Báo cáo khoa học: "Fast and accurate query-based multi-document summarization" docx
... Computational LinguisticsFastSum: Fast and accurate query-based multi-document summarizationFrank Schilder and Ravikumar KondadadiResearch & DevelopmentThomson Corp.610 Opperman Drive, Eagan, ... 2007), pages 757–766,Banff, Canada.B. Efron, T. Hastie, I.M. Johnstone, and R. Tibshirani.2004. Least angle regression. Annals of Statistics,32(2):407–499.S. Gupta, A. Nenkova, and D. Jurafsky. ... 2004. Rouge: a package for automatic evaluationof summaries. In Proceedings of the Workshop on TextSummarization Branches Out (WAS 2004). A. Nenkova and L. Vanderwende. 2005. The impact offrequency...
- 4
- 215
- 0
báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx
... research and rehabilitation. Assist Technol 2004, 16:54-62.6. Sherman W, Craig A: Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002. 7. Stanney ... under what circumstances a computer generated environment should be consideredvirtual reality? Factors that differ among many of the lab-oratories claiming to use virtual reality and that alsoemerge ... this month. Viau et al. com-pare the kinematic strategies of reach, grasp, and placemovements performed with physical and virtual objectsby healthy adults and those with hemiparesis. Sveistruppresents...
- 2
- 360
- 0
Báo cáo hóa học: " Heavily glycosylated, highly fit SIVMne variants continue to diversify and undergo selection after transmission to a new host and they elicit early antibody dependent cellular responses but delayed neutralizing antibody responses" pdf
... Wang S, Hui H, Kappes JC, Wu X, Salazar-Gonzalez JF, Salazar MG, Kilby JM, Saag MS, Komarova NL, NowakMA, Hahn BH, Kwong PD, Shaw GM: Antibody neutralization and escape by HIV-1. Nature 2003, 422(6929):307-312.15. ... infecting variant (data notshown). For animals infected with the early variant, therewas no length variation at 40 weeks and little length vari-ation at ~75 weeks (7% in one animal). Some animalsinfected ... intermediate and late variants also hadno length variation, while others demonstrated extensivevariation (up to 80% in one animal). Although animalsinfected with the late variants had more...
- 15
- 490
- 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... 5-GAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGT-3Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGCACAGAGCTGCAAACAACTA-3Type-specific PCRupper primerTGT GCT GCC ATA TCT ACT TCA GAA ACT ACType-specific ... crystalline phase of superparamag-netic nanoparticles.Table 1 Hybridization probes and type-specific PCRprimersSequenceCapture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGT-3Secondary ... imaging, labelling and sensing.Nat Mater 2005,4:435-446.16. Ma HL, Qi XR, Maitani Y, Nagai T: Preparation and characterization ofsuperparamagnetic iron oxide nanoparticles stabilized by alginate....
- 9
- 469
- 0
Báo cáo hóa học: " Research Article Fast and Accurate Video PQoS Estimation over Wireless Networks" pot
... for estimating the PQoSindex in a fast and easy way. The proposed analytical modelhas an average pearson correlation coefficient of 0.986, asproof of its robustness and reliability in many network0.350.450.550.650.750.850.951.051.151.251.35Analytical ... (CCECE’06), pp. 1846–1849, Ottawa, Canada, May 2006.[36] D. Vassis, G. Kormentzas, A. Rouskas, and I. Maglogiannis,“The IEEE 802.11g standard for high data rate WLANs,” IEEENetwork, vol. 19, ... Reisslein, and S. Panchanathan, A framework for advanced video traces: evaluating visual qualityfor video transmission over lossy networks,” EURASIP Journalon Applied Signal Processing, vol. 2006, Article...
- 10
- 416
- 0
Báo cáo hóa học: " Fast and Accurate Ground Truth Generation for Skew-Tolerance Evaluation of Page Segmentation Algorithms" potx
... Maryland, USA. His research interests are in ma-chine vision and image analysis. His current research focuses ontexture analysis, face image analysis, and machine vision for sens-ing and understanding ... two advantages.Firstly, we know the skew angle and secondly, we exclude thescaling and translation, that is, we avoid a sophisticated, timeconsuming and not always accurate document registrationprocedure.2In ... have such a shape. This isrelated to the area of the representative square. For angles be-tween−90◦ and 0◦, this area reaches a maximum at extremevalues of this range and it is minimal...
- 10
- 326
- 0
Báo cáo y học: " The influence of psychiatric screening in healthy populations selection: a new study and metaanalysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality traits" ppt
... and rs25531polymorphisms and anxiety-related personality traitsAlessandra Minelli1, Cristian Bonvicini1, Catia Scassellati1, Riccardo Sartori2 and Massimo Gennarelli1,3*AbstractBackground: ... Gade-Andavolu R, Gonzalez N, Wu S, Muhleman D, Blake H,Mann MB, Dietz G, Saucier G, MacMurray JP: A multivariate analysis of 59candidate genes in personality traits: the temperament and characterinventory. ... thestatistical analyses and carried out all genetic analyses; CS participated in thedesign and coordination of the study and co-wrote the manuscript; RSperformed the statistical analyses and...
- 12
- 400
- 0
Báo cáo y học: " Withdrawal of inhaled corticosteroids in individuals with COPD - a systematic review and comment on trial methodology" ppt
... acceptable le vel ofbias for three or more bias criteria (Table 3). The fourthtrial appeared to have a much greater potential for bias,was substantiall y different in s ize and design, and had a different ... a meta-analysis on outcome datafrom trials which we rated as acceptable in terms of biason at least three of the five bias criteria listed above, and only when relevant data could be obtained ... Explanatory and pragmatic attitudes intherapeutical trials. Journal of Chronic Diseases 1967, 20:637-648.23. Peto R, Collins R, Gray R: Large-scale randomized evidence: large, simpletrials and...
- 10
- 394
- 0
Báo cáo sinh học: "A new, fast algorithm for detecting protein coevolution using maximum compatible cliques" pptx
... contributionsAR developed, designed and programmed the algorithm under thesupervision of JR and ERMT. AB prepared the sequence data for analysis,performed the accuracy and speed tests and analyzed ... compare the accuracy and performance of MMMvIIto those of the original MMM an evaluation data setcomprised of pairs of distance matrices was compiledusing the OMA d atabase [16]http://www.omabrowser.com.We ... test of com-patibility within the new match, and is an approximateheuristic designed to be fast rather than exact. Therationale behind designing this algorithm was that a fullcompatibility test...
- 9
- 325
- 0
docomo japan s wireless tsunami how one mobile telecom created a new market and became a global fo phần 1 pdf
... cor-porations, professional associations, and other organizations. For details, con-tact Special Sales Department, AMACOM, a division of American Manage-ment Association, 1601 Broadway, New York, ... a New Market and Became a Global ForceJOHN BECK AND MITCHELL WADEAmerican Management Association New York ãAtlanta ãBrussels ãBuenos Aires ãChicago ãLondon ãMexico CitySan Francisco ... us to propose a radical, almost embarrassingidea: In managing your business, human passions matter. A lot. Morethan any of us admit, and certainly more than we act on. (And we arexii Introduction...
- 26
- 247
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25