a new basis for order

Food and health in Europe: a new basis for action pdf

Food and health in Europe: a new basis for action pdf

Ngày tải lên : 16/03/2014, 14:20
... Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania ... Greece Malta Italy Spain Portugal Israel France Switzerland Netherlands Germany United Kingdom Austria Belgium Sweden Denmark Norway Finland Yugoslavia Bulgaria Hungary Romania Slovakia Czech ... information and data so that they can make informed decisions to prevent harm Nationally collected data can be compared with international norms and standards to ensure that public health is at...
  • 38
  • 334
  • 0
Food and health in Europe: a new basis for action pptx

Food and health in Europe: a new basis for action pptx

Ngày tải lên : 28/03/2014, 23:20
... Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania Romania Azerbaijan Belarus Armenia Republic of Moldova Kyrgyzstan Uzbekistan 50 100 150 200 250 300 Availability ... Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary ... tropical-plant fat and oil, are also strong stimulators for raising LDL levels, as are some transfatty acids (49) A major saturated fat, stearic acid, present in beef fat and lard, a 300 Men 200 100 Deaths...
  • 405
  • 635
  • 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Ngày tải lên : 12/08/2014, 23:23
... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... subcutaneously with PMPA, 20 mg/kg/day, and FTC, 50 mg/kg/day Quantitative assay for SIVmac251 viral RNA levels For measurement of plasma SIVmac251 RNA levels, a quantitative TaqMan RNA reverse transcription-PCR...
  • 19
  • 317
  • 0
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Ngày tải lên : 31/10/2012, 14:59
... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...
  • 11
  • 715
  • 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Ngày tải lên : 15/12/2013, 06:15
... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... a certain prejudice towards certain people or race, try to make an extra effort to love them unconditionally For example, if you are biased against Muslims in general, make an extra effort to...
  • 59
  • 770
  • 3
A new algorithm for enumeration of minimum cutsets of graph by branch addition

A new algorithm for enumeration of minimum cutsets of graph by branch addition

Ngày tải lên : 03/01/2014, 19:35
... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... node are shown in Table The calculations have made by Matlab version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied to a part of Iran transmission and ... Enumeration of Minimal Cutsets Separating Vertices in a Class of Undirected Planar Graphs," IEEE Trans on Reliability, Vol 41, No 1, March 1992 Li Yan, Hamdy A Taha, Thomas L Landers, "A Recursive...
  • 6
  • 545
  • 0
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Ngày tải lên : 23/01/2014, 07:20
... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... this as an input to a separate "playback" application The "playback" is not strictly a playback in the sense that users are still allowed to move about and interact in the virtual world An example ... used for VR applications Currently, all major UNIX workstation vendors have specific platforms targeted to the VR market These workstations usually have a enhanced graphics performance and specific...
  • 10
  • 634
  • 1
Tài liệu A New Era for Conservation docx

Tài liệu A New Era for Conservation docx

Ngày tải lên : 25/01/2014, 20:20
... Upgrade, and Increase Monitoring, Data Analysis and Management; • Plan for and Adapt to Sea Level Rise; and • Identify and Fund Focused Climate Change Impacts and Adaptation Research and Analysis ... changes associated with climate change are already having a significant biological impact across a broad range of natural systems For example, across North America, plants are leafing out and ... the capacity of many organisms to adapt in this classical sense U.S natural resource managers and conservationists are accelerating their plans and actions for climate change adaptation, in large...
  • 69
  • 440
  • 0
Tài liệu Dollar Cost Banding - A New Algorithm for Computing Inventory Levels for Army Supply Support Activities pdf

Tài liệu Dollar Cost Banding - A New Algorithm for Computing Inventory Levels for Army Supply Support Activities pdf

Ngày tải lên : 17/02/2014, 17:20
... (Mech) 82nd ABN 82nd Airborne Division AAC Acquisition Advice Code ABF Availability Balance File AMC Army Materiel Command ASB Aviation Support Battalion ASL Authorized Stockage List AVIM Aviation ... repair times, and reduced equipment availability In many cases, maintainers who were unable to wait any longer for parts to maintain readiness had to make extra efforts to work around part availability ... Decisions, Santa Monica, CA: RAND Corporation, MR-1150 -A, 2002; Marygail K Brauner et al., Dollars and Sense: A Process Improvement Approach to Logistics Financial Management, Santa Monica, CA: RAND...
  • 132
  • 425
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20
... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
  • 11
  • 873
  • 0
Tài liệu A New Paradigm for Economic Development docx

Tài liệu A New Paradigm for Economic Development docx

Ngày tải lên : 20/02/2014, 19:20
... academic patents awarded to academic researchers in each state, relative to the number of science and engineering doctorate holders in academia California, Massachusetts, Florida, Maryland, and ... Research Triangle Park The idea for a research park in the Raleigh-Durham-Chapel Hill area began in the 1950s, spawned by a disparate cast of characters that included bankers, professors, real ... Utah Iowa North Carolina Alaska 10 Alabama Based on state and local spending per capita on higher education For details see Table 10 Rockefeller Institute Page 47 www.rockinst.org Higher Education...
  • 74
  • 410
  • 0
A New Vision for Adolescent Sexual and Reproductive Health pot

A New Vision for Adolescent Sexual and Reproductive Health pot

Ngày tải lên : 05/03/2014, 17:20
... sexual behavior, use of contraception, and use of abortion An important reason that European youth have better sexual health outcomes is that adults approach teenage sexuality differently than adults ... adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... European levels without fundamental changes in adult social in adult social norms norms regarding access to health information and to reproductive regarding access to health services health information...
  • 7
  • 662
  • 0
A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

A NEW TOOL FOR SCALING IMPACT: HOW SOCIAL IMPACT BONDS CAN MOBILIZE PRIVATE CAPITAL TO ADVANCE SOCIAL GOOD doc

Ngày tải lên : 06/03/2014, 08:20
... interventions A New Tool for Scaling Impact 15 15 outcomes (such as smoking cessation) are achieved Foundations could act as payor via performance-based grants on projects that have large societal value, ... Collaboration with relevant government agencies will also be necessary to gain access to administrative data, such as Medicaid records Administrative data will allow evaluators to assess program ... risks, as well as financial and social returns, are properly articulated and managed They will require tools, such as a credit scorecard, that reflect an intermediary’s methodical and careful...
  • 36
  • 262
  • 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Ngày tải lên : 07/03/2014, 09:20
... cathepsin D activity J Pept Sci 11, 166–174 31 Yasuda Y, Kageyama T, Akamine A, Shibata M, Kominami E, Uchiyama Y & Yamamoto K (1999) Characterization of new fluorogenic substrates for the rapid and sensitive ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with ... Hayakumo T & Nakajima M (1996) Expression of cathepsin E in pancreas: a possible tumor marker for pancreas, a preliminary report Int J Cancer 67, 492–497 22 Uno K, Azuma T, Nakajima M, Yasuda...
  • 12
  • 645
  • 0
Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

Ngày tải lên : 08/03/2014, 02:21
... 2: Example of a simple grammar lattice All grammars generate a common lexicon for all the grammars) A Grammar Lattice as a Search Space for Grammar Induction a Rule generalization steps a c s ... constraint-based grammars for natural language specifically designed to enable learning from representative examples annotated with semantics We have presented a new grammar learning model and showed ... representative examples associated with a LWFG conformal w.r.t a sublanguage , and as then can always be learned from ) the grammar lattice top element ( Based on the theoretical foundation of...
  • 8
  • 402
  • 0
A New Formula for Child Health: Doctors Communities + Healthy Kids pdf

A New Formula for Child Health: Doctors Communities + Healthy Kids pdf

Ngày tải lên : 14/03/2014, 09:20
... booth and other health and safety games and arts booths Another parent was in charge of sharing information about the health fair at Café el Director, a monthly bilingual L to R: Juanita (with granddaughter ... local radio station 1430AM and operates the Diaspora Newspaper in the Greater Sacramento region The only group of its kind in the area, Afisha is a major source of news and information for the ... before her, identified the Russian/English language barrier as a huge challenge for health and healthcare Instead, for the first time, Dr Inessa recognized that her native language was an asset...
  • 94
  • 252
  • 0
Case handling: a new paradigm for business process support pot

Case handling: a new paradigm for business process support pot

Ngày tải lên : 15/03/2014, 21:20
... free A1 A2 D4 A3 mandatory Skip mandatory R2 mandatory restricted mandatory D1 D2 D3 Fig Abstract example introducing the schema level of the case handling meta model mandatory for A1 , A2 and A3 ... definitions As indicated above, D1 is mandatory for A1 , A2 and A3 , D2 is mandatory for A2 , while D3 is restricted for A3 D0 and D4 are free data elements, which appear in form definition F3, associated ... each activity with which they are associated There are activities without forms to cater for automatic activities, for example automated queries to external database systems Fig assumes that at...
  • 34
  • 524
  • 0
A new mechanism for modulation of schottky barrier heights on silicon nanowires

A new mechanism for modulation of schottky barrier heights on silicon nanowires

Ngày tải lên : 16/03/2014, 15:14
... and drain and the silicon substrate as a back-gate, a transistor configuration can be defined as shown in Fig 5 (a) Transfer characteristics at different temperatures for a constant drain voltage ... surface concentration taking this depth as a reasonable value for substantial tunneling This gives an energy lowering similar to the experimental data as given in Ref [10] Schottky barriers at nanowire ... The values in regime A are found in the range of 0.15 eV, while regime B has a sharp maximum at 0.55 eV and regime C again decreases the activation energy to about 0.25 eV All these values are...
  • 5
  • 398
  • 0
Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

Ngày tải lên : 17/03/2014, 00:20
... Innovative applications of artificial intelligence, AAAI’97/IAAI’97, pages 598–603 AAAI Press Michael Collins and Terry Koo 2005 Discriminative reranking for natural language parsing Computational ... Canasai Kruengkrai, Kiyotaka Uchimoto, Jun’ichi Kazama, Yiou Wang, Kentaro Torisawa, and Hitoshi Isahara 2009 An error-driven word-character hybrid model for joint Chinese word segmentation and ... Speech and Natural Language, HLT ’91, pages 306–311, Morristown, NJ, USA Association for Computational Linguistics Adam L Berger, Vincent J Della Pietra, and Stephen A Della Pietra 1996 A maximum...
  • 10
  • 476
  • 0
Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

Ngày tải lên : 17/03/2014, 10:20
... the autoxidation reaction of each chain, above the basal A B processes in water with the rate constants k0 and k0 In fact, the catalytic proton enhances the rate dramatically both in the separated ... located at position 58 for the a chain and at position 63 for the b chain, appears to participate by a proton-relay mechanism the same as in mammalian oxymyoglobins [21,24] Indeed, random and undirected ... range as follows: Table Rate constants and acid dissociation constants obtained from the pH-dependence curves for the autoxidation rate of the separated a and b chains in 0.1 M buer at 35 C Taken...
  • 11
  • 371
  • 0

Xem thêm