a new approach for burr minimization

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Ngày tải lên : 07/03/2014, 09:20

... cathepsin D activity J Pept Sci 11, 166–174 31 Yasuda Y, Kageyama T, Akamine A, Shibata M, Kominami E, Uchiyama Y & Yamamoto K (1999) Characterization of new ﬂuorogenic substrates for the rapid and sensitive ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deﬁcient mice show increased susceptibility to bacterial infection associated with ... Hayakumo T & Nakajima M (1996) Expression of cathepsin E in pancreas: a possible tumor marker for pancreas, a preliminary report Int J Cancer 67, 492–497 22 Uno K, Azuma T, Nakajima M, Yasuda...

12
645
0

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening afﬁnity-enhanced proteins doc

Ngày tải lên : 22/03/2014, 21:20

... and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and ... The fragments encoding Z variants were ampliﬁed from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, and inserted ... DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the NotI–SacI site of pLMZ -WT and pLMZ-K3 5A, yielding plasmids pLMZ-WT-H and...

9
356
0

Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Ngày tải lên : 23/06/2014, 01:20

... of adaptive TFDs is based on signal decomposition In practice, no TFD may satisfy all the requirements needed for instantaneous feature extraction and identiﬁcation for nonstationary signal analysis ... The vectors are selected from a family of waveforms called a dictionary The signal x(t) is projected onto a dictionary of TF atoms obtained by scaling, translating, and modulating a window function ... (MPTFD), has good signal representation and is appropriate for analysis of nonstationary, multicomponent signals The extraction of coherent structures makes MP an attractive tool for TF representation...

8
355
0

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Ngày tải lên : 11/08/2014, 10:23

... harvested and stained for DC maturation markers without fixation Immediately before FACS analysis µg/ml 7-ADD was added as viability indicator The dot plots shown the total cells in the floating ... 3H-thymidine was added to each well and the plates harvested 18 h later Irradiated PBMC from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of ... T-cell-based immune responses against viral disease and cancer [1] Recently, this powerful ability of DC is being tested as an active vaccine approach to treat cancer and viral infections such as...

11
469
0

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

Ngày tải lên : 13/11/2014, 10:46

... TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC ... 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA 16 TTTGCGGCCGCATGGATGATGATATCGCCGCG 17 TTTCTCGAGCTAGAAGCATTTGCGGTGGAC ... TTTCTCGAGCTAGAAGCATTTGCGGTGGAC 18 CTCAGATCTCGGGCTATGGATGATGATATCGCCGC 19 TCGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG 20 TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG...

144
306
0

Performance management a new approach for driving business results

Ngày tải lên : 25/11/2016, 09:40

... straightforward and easy to implement that they miss what it really takes to gain value and results from a performance management process What happens is that “flavor of the day” performance management ... xi Part I A Primer on Performance Management Chapter The Truth about Performance Management What Makes Performance Management So Hard? The Goal of This Book Chapter How Did We Arrive at Today’s ... concrete and practical development and implementation steps that human capital professionals and managers can apply in their own work situations Part I A Primer on Performance Management Performance...

207
474
0

A new approach for learning discriminative dictionary for pattern classification

Ngày tải lên : 16/12/2017, 06:58

... between the atoms and the class labels that would allow increasing classification performance There are a number of approaches where the main idea is to learn a sub-dictionary for each class using ... Dictionary Learning (FDDL) FDDL used the training data set of each class to learn a sub-dictionary for that class After all sub-dictionaries for all class are learned, a large common dictionary ... recently approaches in dictionary learning based classification tasks For future work, our approach can be extended in several ways We plan to investigate the sharing features approaches such as [23]...

15
133
0

A New Approach for Optimizing Traffic Signals in Networks Considering Rerouting

Ngày tải lên : 16/12/2017, 15:47

... Pham Dinh, T., Le Thi, H .A. : Convex analysis approach to d.c Programming: Theory, Algorithms and Applications Acta Mathematica Vietnamica 22(1), 289– 355 (1997) 20 Pham Dinh, T., Le Thi, H .A. : ... problem: A genetic approach In: Bell, M.G.H (ed.) Transportation Networks: Recent Methodological Advances, pp 163–174 Pergamon, Oxford (1998) Fitsum, T., Agachai, S.: A genetic algorithm approach for ... time on path p, ﬂow on path p, travel time for OD pair w, waiting time at junction h associated to path p, initial waiting time at junction h associated to path p, integer variables, that is used...

12
143
0

A new approach to financial regulation: the blueprint for reform potx

Ngày tải lên : 29/03/2014, 18:20

... undertake, as far as possible before formal legal powers are created, the permanent body’s macro-prudential role, in addition to vital preparatory work and analysis into potential macro-prudential ... cultural changes arising from the creation of a specialist authority will be a vital part of achieving the objectives of the reform In particular, the FCA will take a more proactive approach to dealing ... regulation of the applicant (the PRA for dual-regulated firms, and the FCA for all others) will manage the application process and ultimately grant permission For dual-regulated firms, the PRA will...

413
413
0

Báo cáo hóa học: " A new approach to geographic routing for location aided cluster based MANETs" pot

Ngày tải lên : 21/06/2014, 03:20

... only a few nodes are GPS enabled and are capable of finding their own location using GPS A few special nodes are equipped with antennas which can measure RSSI and the angle of arrival (AOA) of ... formation of a cluster whereas Cluster Adjacency Table (CAT) is used for keeping information about the adjacent clusters In CAT, CH stores the IDs of the adjacent CHs, gateway node IDs to reach adjacent ... reliable data sharing and communication between highly mobile vehicles i.e., VANETs for the present and in the future List of Abbreviations AOA: angle of arrival; CAT: Cluster Adjacency Table;...

10
482
0

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

Ngày tải lên : 26/01/2016, 09:27

... comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved in acetone and treated with a catalytic amount of p-toluenesulfonic acid Compound was obtained (crystalline ... tert-butyl acetate22 (generated from tert-butyl acetate and LDA in THF at À78 °C) to 21 afforded an adduct that was desilylated without puriﬁcation The mixture of diols 22 so obtained was oxidized ... by Danishefsky et al for a related diol.4d,24 The hydroxy-aldehyde 25 obtained in 60–70% yield was acetylated with acetic anhydride in the presence of DMAP and triethylamine to give acetate 26...

3
547
0

Runge Kutta methods for DAEs A new approach

Ngày tải lên : 21/12/2016, 10:24

... approximation For a nonsti y accurate method, even if A is constant, the classical approach and the new approach give di erent results If we use (12) and (13) to get the new approach, as Ax˜n+1 = Ax n+1 ... direct approach Remark For Lobatto IIIA methods, the matrix A is singular but the submatrix A = (aij )i; j¿2 is invertible and the method is sti y accurate This new approach can be also applied ... ; ka; l : Proof In this case we have to study (17) Remember that Corollary 2.4 states that for constant A the new approach with xn+1 = Xs and the classical approach give the same approximation...

13
157
0

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Ngày tải lên : 31/10/2012, 14:59

... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...

11
715
0

A New Approach to Quantum Theory

Ngày tải lên : 06/11/2012, 11:21

... contact transformations,” which has an important quantum mechanical analogue, namely, the transformation matrix (qt |qT ) This matrix connects a representation with the variables q diagonal at ... gives probably the most fundacorresponds to e mental quantum analogue for the classical Lagrangian function It is preferable for the sake of analogy to consider the classical Lagrangian as a function ... classically as a consequence of a principle of least action, and cannot, it appears, be expressed in Hamiltonian form For this reason a method of formulating a quantum analog of systems for which...

142
574
0

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

Ngày tải lên : 10/04/2013, 14:46

... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern ... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make...

44
1.7K
7

a decentralized approach for implementing identity management in cloud computing

Ngày tải lên : 31/07/2013, 09:43

... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach s accompanying high rate of false positives There are ... for IdM, Privacy and Identity Management for Europe (PRIME), Windows CardSpace, and OpenID Also they propose an entity-centric approach for IdM in the cloud that based on active bundles and anonymous ... anomaly behavior or not As demonstrated in [11], a basic assumption of anomaly detection is that attacks differ from normal behavior But the definition of what’s normal and what’s abnormal is ambiguous...

7
589
0

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Ngày tải lên : 15/12/2013, 06:15

... lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affirmations work for anyone, has this to say about affirmations: “By definition, an affirmation ... poem like a mantra as often as I can remember: Thank you for the abundance, Thank you for the wealth; Thank you for all the happiness, Protections and Good Health Repeat this mantra consistently ... a certain prejudice towards certain people or race, try to make an extra effort to love them unconditionally For example, if you are biased against Muslims in general, make an extra effort to...

59
770
3

A new algorithm for enumeration of minimum cutsets of graph by branch addition

Ngày tải lên : 03/01/2014, 19:35

... Billinton and C Singh, ''Generating capacity reliability evaluation in interconnected systems using a frequency and duration approach, Part I: Mathematical analysis,'' IEEE Trans on Power Apparatus ... node are shown in Table The calculations have made by Matlab version 6.5 The cutsets of this graph have calculated in 0.8 second This algorithm also has applied to a part of Iran transmission and ... Enumeration of Minimal Cutsets Separating Vertices in a Class of Undirected Planar Graphs," IEEE Trans on Reliability, Vol 41, No 1, March 1992 Li Yan, Hamdy A Taha, Thomas L Landers, "A Recursive...

6
545
0

Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx

Ngày tải lên : 23/01/2014, 07:20

... component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a much Fig 14.2 ... this as an input to a separate "playback" application The "playback" is not strictly a playback in the sense that users are still allowed to move about and interact in the virtual world An example ... used for VR applications Currently, all major UNIX workstation vendors have specific platforms targeted to the VR market These workstations usually have a enhanced graphics performance and specific...

10
634
1

Tài liệu A New Era for Conservation docx

Ngày tải lên : 25/01/2014, 20:20

... Upgrade, and Increase Monitoring, Data Analysis and Management; • Plan for and Adapt to Sea Level Rise; and • Identify and Fund Focused Climate Change Impacts and Adaptation Research and Analysis ... changes associated with climate change are already having a significant biological impact across a broad range of natural systems For example, across North America, plants are leafing out and ... Climate Change Adaptation Literature March 12, 2009 III SECTOR-SPECIFIC ADAPTATION STRATEGIES A Forests Climate Change Impacts and Vulnerability Assessment Approaches Climate change is already affecting...

69
440
0