... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... features of contrastive analysis in learning a foreign language which has particular effect on analyzing a language and its equivalents in other languages and then the author would like to make ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern...
Ngày tải lên: 10/04/2013, 14:46
... abuse, and against violence towards women and girls as a human rights violation; and for programmes “to encourage and enable men to adopt safe and responsible sexual and reproductive behaviour, and ... Gender-Based Approach , Sexual Health Exchange 1998, no 2, pp 3–6 83 T Valdés and J Olvarríra, eds, “Masculinidades y equidad de genéro en America Latina” 21 Partnering: A New Approach To Sexual And ... Model of Masculinity and New Paradigms of Fatherhood 119 Old Paradigm: Masculinity New Paradigm: Fatherhood Primary and sole financial provider Authoritarian disciplinarian Shares financial-provider...
Ngày tải lên: 05/03/2014, 16:20
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... 2007 The Authors Journal compilation ª 2007 FEBS N Zaidi et al Parallel detection of CatE and CatD activity TAPA and specific catalytic activities of CatE and CatD were determined fluorimetrically ... determination of subcellular localization of CatE and CatD, western blot analysis was performed No CatE was recovered from any subcellular fraction of WT100 Endosomal fractions of DCs and HaCaT contained...
Ngày tải lên: 07/03/2014, 09:20
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx
... regard to paper manufacturing and the end-uses of paper products as well as in paper recycling Almost as long as man has made paper, first by hand and then industrially, different additives have ... selluloosamallipinnalle ilman elektrostaattisen attraktion vaikutusta Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin selluloosapintojen välisen adheesion ... In contrast to xyloglucan and CMC, addition PDADMAC induced a sharp increase in frequency and a decrease in dissipation, indicating a reduction of the detected mass and an increase in elasticity...
Ngày tải lên: 18/03/2014, 02:20
Báo cáo toán học: " A new approach to investigate the interactions between sediment transport and ecotoxicological processes during flood events" ppt
... kg−1) A total amount of about 700 kg artificial sediment was prepared for the experiments in the annular flume and half of the sediment was spiked with the abovedescribed PAHs This approach was ... physico-chemical parameters were logged and analysed The mean oxygen content was CO2 = 8.52 mg/l, the mean temperature was T = 12.66°C and the mean pH was pH 7.64 Measurements of physico-chemical water parameters ... glutathione-S-transferase and catalase activity, lipid peroxidation), gene expression analyses (quantitative real-time RT-PCR), determination of cytochrome P450 1A1 (CYP 1A1 ) protein content, chemical analysis...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " Research Article A New Approach to q-Bernoulli Numbers and q-Bernoulli Polynomials Related to q-Bernstein Polynomials" pdf
... International Conference of Numerical Analysis and Applied Mathematics (ICNAAM ’10), AIP, Rhodes, Greece, March 2010 L Carlitz, “q-Bernoulli numbers and polynomials,” Duke Mathematical Journal, ... polynomials,” in ¸ ¨ Proceedings of the 8th International Conference of Numerical Analysis and Applied Mathematics (ICNAAM ’10), AIP, Rhodes, Greece, March 2010 M Acıkgoz and Y Simsek, A new generating ... 987–1000, 1948 Advances in Difference Equations V Kac and P Cheung, Quantum Calculus, Universitext, Springer, New York, NY, USA, 2001 T Kim, A new approach to q-zeta function,” Advanced Studies...
Ngày tải lên: 21/06/2014, 07:20
Sectors and Styles - A New Approach to Outperforming the Market docx
... whom I am proud to call friends and colleagues Many thanks go to Jason and Jane Welsch, Bharath Chandar, Joseph Roccasalvo, George and Andrea Fulop, Emily and Len Brizzi, Gino and Donna Albertario, ... Albertario, Vahan Janjigian, Annette and Clint Welch, Don Horenstein, Mark Wachs, John Mihale, Mark and Roberta Aaronson, Rocco Papandrea, Milan Miletic, Maris Ogg, Ed McDonough, Connie Dambra, Maria Rudic, ... action and economic performance, and the markets’ take on both It is a rich and robust way to analyze all the important aspects of both the real economy (the G and E part) and the financial economy...
Ngày tải lên: 28/06/2014, 21:20
capital structure and firm performance a new approach to testing agency theory and an application to the banking industry
... Estimation: Ownership Sample and Full Sample Means and Standard Deviations for 1990-95 All financial variables measured in 1000's of constant 1994 dollars Prices of financial assets and liabilities ... purchased funds, loans, etc Specifying financial assets as outputs and financial liabilities and physical factors as inputs is consistent with the intermediation approach or the asset approach ... these additional banks are owner managed rather than professionally managed, and therefore not provide a good laboratory for testing the agency costs of the separation of ownership and management.19...
Ngày tải lên: 13/07/2014, 21:13
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
... TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC ... 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA 16 TTTGCGGCCGCATGGATGATGATATCGCCGCG 17 TTTCTCGAGCTAGAAGCATTTGCGGTGGAC ... TTTCTCGAGCTAGAAGCATTTGCGGTGGAC 18 CTCAGATCTCGGGCTATGGATGATGATATCGCCGC 19 TCGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG 20 TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG...
Ngày tải lên: 13/11/2014, 10:46
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model
... Materials and Methods Statistical analysis Data are presented as mean ± SE Statistical significance was analyzed by variance (ANOVA), a Tukey test was applied when necessary for comparisons A value ... regulates many essential functions such as maintaining background vasodilatation in small arteries and arterioles, regulation of microvascular and epithelial permeability NO’s role as a neurotransmitter ... area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the percentage of the original area for each group of rats The data of 6th day suggests the largest...
Ngày tải lên: 26/09/2015, 09:39
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene
... ethanol15 to give alkene 10 Careful acetylation of 10 with acetic anhydride and DMAP in dichloromethane gave the acetate 11 contaminated with (presumably) its cis-azulene epimer (10% by H NMR) All ... comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved in acetone and treated with a catalytic amount of p-toluenesulfonic acid Compound was obtained (crystalline ... tert-butyl acetate22 (generated from tert-butyl acetate and LDA in THF at À78 °C) to 21 afforded an adduct that was desilylated without purification The mixture of diols 22 so obtained was oxidized...
Ngày tải lên: 26/01/2016, 09:27
The Republic of Beliefs A New Approach to Law and Economics
... saying above is that if a law changes (in traditional law and economics), that basically changes the game that people play, that is their payoffs change or the set of strategies available change ... have called our approach thus far more accurately the focal point approach with neo-classical features.’ What I am moving on to now is a recognition that human preferences are malleable and can ... their altered role mechanically, at the moment of adopting a new law (World Bank, 12 approach to law and economics, and it has sullied a lot of our analysis and hurt the policies we have crafted...
Ngày tải lên: 23/04/2016, 05:04
A New Approach to Quantum Theory
... xn (a) and which leaves the action invariant (for example, the transformation may be a rotation) The transformation is to contain a parameter, a, and is to be a continuous function of a For a equal ... mechanically The principal reason was the use of half-advanced and half-retarded interaction The Hamiltonian method describes and keeps track of the state of the system of particles and fields at ... contact transformations,” which has an important quantum mechanical analogue, namely, the transformation matrix (qt |qT ) This matrix connects a representation with the variables q diagonal at...
Ngày tải lên: 06/11/2012, 11:21
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf
... Defense, and Homeland Security; the Federal Aviation Administrations (FAA); the National Aeronautics and Space Administration (NASA); and the White House Office of Science and Technology to plan the ... implementing a transformation: the Sandia National Laboratories approach, a four-level transformation model that focuses on identifying a transformation trigger, and an eight-factor public management ... impose a transformational change into their organizations (Slavin and Woodard 2006, 23): We close with a caution and a challenge Transformation has many elements, and the failure of any one can doom...
Ngày tải lên: 15/02/2014, 20:20
Tài liệu electronic finance a new approach to financial sector development pot
Ngày tải lên: 23/02/2014, 11:20
Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx
... Multilingual Information Extraction and Summarization, pages 17–24 M Friedman and A Kandel 1994 Fundamentals of Computer Numerical Analysis CRC Press D Liu, Y He, D Ji, and H Yang 200 6a Genetic algorithm ... of Language Resources and Evaluation We are grateful to Michael Elhadad and Galina Volk from Ben-Gurion University for providing the ROUGE toolkit adapted to the Hebrew alphabet, and to Slava Kisilevich ... crossover, and mutation In mating, a pair of “parent” solutions is randomly selected, and a new solution is created using crossover and mutation, that are the most important part of a genetic algorithm...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: "Question Answering as Question-Biased Term Extraction: A New Approach toward Multilingual QA" doc
... paragraphs Table 3: Answer Extraction from Top N documents Feature set Match TE (DF) Top N paragraphs Exact Partial Exact Partial Exact Partial Exact Partial Exact Partial Exact Partial Exact ... Della Pietra: A Maximum Entropy Approach to Natural Language Processing, Computational Linguistics, Vol 22, No 1, pp 39–71 (1996) 221 Abdessamad Echihabi and Daniel Marcu: A NoisyChannel Approach ... (NICT), Japan A machine learning approach to hierarchical question analysis was reported in (Suzuki et al., 2003), but training and maintaining an answer extractor for question types of fine granularity...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc
... and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... the case analysis 4.2 Algorithm Given an input phrase N1 no N2, b o t h D B A and SBA are applied to the input, and then the two analyses are integrated 4.2.1 Dictionary-based Analysis Dictionary ... the parsing system In Proceedings of the First International Conference on Language Resources ~ Evaluation, pages 719724 Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... ng and rn represent single segments), that the feet are /pangu/ and /pangurnu/ and that there is a single prosodic word, namely/pangupangurnu/ The syntactic parser for Warlpiri which we have ... ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example illustrates a number of instances of...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt
... designators: Its clause number (C), A Status Flag (v) to indicate whether the predicate of the clause has or has not occurred, Its phrase number (P), and A Backward Flag (b) to indicate a particular ... correspondents are enclosed in brackets They may appear as some combination of the following word-sections: a a translated initial prefix b a transliterated full or partial stem c a transliterated full ... indicates that a new clause is starting, the predictions of a new subject and predicate are entered as foresights b The main routine This may yield predictions of a general nature on the basis...
Ngày tải lên: 16/03/2014, 19:20