a neurodevelopmental journey from genes to behaviour

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

... 8784–8792 Kawana Y, Kawana K, Yoshikawa H, Taketani Y, Yoshiike K & Kanda T (2001) Human papillomavirus type 16 minor capsid protein L2 N-terminal region containing a common neutralization epitope ... HPV16 is endocytosed via a clathrin- and caveolinindependent pathway, whereas BPV1 and HPV31 were shown to enter via clathrincoated pits and caveolae, respectively Additional details are provided ... HSPGs contain unbranched oligosaccharides composed of alternating disaccharide units of uronic acid and glucosamine, which are sulfated and acetylated to various degrees O-sulfation occurs at the...

Ngày tải lên: 23/03/2014, 04:20

11 511 0
a journey from robot to digital human

a journey from robot to digital human

... as artificial ears and eyes Ten years later, they created a new Wabot-2 as a musician humanoid robot that was able to communicate with a person, read a normal musical score by his eyes and play ... in Tokyo, Japan in 1973 Wabot-1 was able to walk, to communicate with a person in Japanese by an artificial mouth, and to measure distances and directions to an object using external receptors, ... local and global kinematics and statics of a digital human in Chapter 9, and creating parts and then assembling them together to build a 3D mannequin in MATLABT M as well as to drive the mannequin...

Ngày tải lên: 01/08/2014, 17:42

600 528 0
Hartwell genetics from genes to genomes 4th

Hartwell genetics from genes to genomes 4th

... Asn AAC AAA Lys AAG AGU AGC AGA AGG GAU Asp GAC GAA Glu GAG GGU GGC GGA GGG Cys portions of the cytochrome C protein in six species: Saccharomyces cerevisiae (yeast), Arabidopsis thaliana (a weedlike ... relatedness of living organisms This chart shows the amino acid sequence for equivalent G Ser UAU Tyr UAC UAA Stop UAG Stop UGU UGC UGA UGG Pro CAU His CAC CAA Gln CAG CGU CGC CGA CGG AAU Asn AAC ... global tools of genomics—such as highthroughput DNA sequencers, genotypers, and large-scale DNA arrays (also called DNA chips)—have the capacity to analyze thousands of genes rapidly and accurately...

Ngày tải lên: 29/12/2013, 12:56

817 1K 1
from genes to genomes

from genes to genomes

... start site +1 −20 −30 −40 −10 CAGGTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACA GTCCAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTGTTAAAGTGT -35 region -10 region mRNA ... chromosomal DNA in bacterial cell extracts In a bacterial cell extract, chromosomal DNA 4.1 EXTRACTION AND PURIFICATION OF NUCLEIC ACIDS Denaturation Chromosomal DNA as linear fragments; plasmid as ... can say that a change in one single base in the genome of a bacterium will make it resistant to a certain antibiotic, or that a change in one base in human DNA could cause debilitating disease...

Ngày tải lên: 11/04/2014, 01:39

360 269 0
COLORECTAL CANCER BIOLOGY – FROM GENES TO TUMOR potx

COLORECTAL CANCER BIOLOGY – FROM GENES TO TUMOR potx

... Synthase Kinase 3 in Colorectal Cancer Progression Toshinari Minamoto, Masanori Kotake, Mitsutoshi Nakada,Takeo Shimasaki, Yoshiharu Motoo and Kazuyuki Kawakami Chapter 107 Molecular Traits ... Ciamporcero, Mario Umberto Dianzani and Giuseppina Barrera Chapter Growth Factors and the Redox State as New Therapeutic Targets for Colorectal Cancer 189 Teodoro Palomares, Marta Caramés, Ignacio ... Garc a- Alonso and Ana Alonso-Varona Chapter 10 Human Tip60 (NuA4) Complex and Cancer 217 Hiroshi Y Yamada Chapter 11 Characterization of the Cell Membrane During Cancer Transformation 241 Barbara...

Ngày tải lên: 27/06/2014, 13:20

458 424 1
Autism Spectrum Disorders - From Genes to Environment

Autism Spectrum Disorders - From Genes to Environment

... Quetiapinea Ziprasidonea Aripiprazolea Clozapinea Antiepileptic (anticonvulsant) Valproic acid Carbamazepine Topiramate Antiopioid (Lance and Anthony, 1975) (Donner and Frisk, 1965) (Maryanoff et al., ... system The activation of specific GABA and glutamate receptors during cell migration is necessary to the regulation of radial and tangential migrations (Manent and Represa, 2007) and an imbalance in ... data demonstrate that the A- C haplotype functions as a transcriptional activator in vitro The A- C haplotype is one of two ASD associated alleles for which function has been ascribed Fig ASD-associated...

Ngày tải lên: 15/04/2015, 17:19

412 409 0
Accenture enterprise transformation marshs journey from vision to realization

Accenture enterprise transformation marshs journey from vision to realization

... Time Wave Canada In Progress – Risk of Delay In Progress – Delayed Wave France Wave Belgium/Luxembourg, Netherlands Wave Korea Wave Australia, New Zealand Wave Brazil Not Started – Risk of Delay ... Not Started – On Time Wave 10 UK (Group 2), Ireland Wave 11 Greece, Italy, Portugal, Spain Wave 12 Taiwan, Singapore, Asia Regional Wave 13 Fiji, Papua New Guinea Wave 14 Wave 15 Snapshot: sample ... Council Manage change and adoption, align to priorities, and screen requests Regional Coordinators Track user adoption, and align to priorities Country Coordinators Drive roadmap, develop plan, track...

Ngày tải lên: 07/03/2016, 18:11

26 159 0
BMC Control-M 7: A Journey from Traditional Batch Scheduling to Workload Automation doc

BMC Control-M 7: A Journey from Traditional Batch Scheduling to Workload Automation doc

... companies to government organizations In recent years, Qiang has travelled hundreds thousands of miles around Australia and the North AP area to help many organizations to design, manage, and ... depth at the technical details of the tool - How to plan, install, use, as well as manage a Control-M environment, and finally look at how to leavage the tool to meet the already sophiscated and ... to serve a particular need Not only that, applications that are specialized in a particular area may also require batch processing Some of these applications such as PeopleSoft Finance and SAP...

Ngày tải lên: 24/03/2014, 04:21

534 1,7K 0
Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc

Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc

... identity to be maintained between the maternal and paternal genomes Remarkably, of the 190 genes that are associated with CNEs in humans and have orthologs in C elegans, 60 have orthologs that are also ... genes are also orthologous to CNE-associated genes in D melanogaster Such an overlap between the sets of CNE-associated genes from three animal phyla is very unlikely to have arisen by chance, and ... C elegans genome Additional data file is a table showing wCNEs overlapping known cis-regulatory elements Additional data file is a table showing the annotation features from WormBase that were...

Ngày tải lên: 14/08/2014, 17:22

14 257 0
From projects to programs a project manager’s journey

From projects to programs a project manager’s journey

... had a problem, and the users are not able to access our health coaches’ dashboard.” Barbara is talking about her current reporting project “Susan, I may have to duck out early,” Barbara says as ... internationally across the United States, Asia, Canada, and Africa Penkar has a Bachelor of Engineering in Electronics and a MBA from Mumbai University in India He is a certified Project Management ... program will touch almost every group in our enterprise Should we treat organizational change management as a major program component?” I add another box to our whiteboard—Organizational Change Management...

Ngày tải lên: 25/10/2016, 18:46

154 488 0
Writing from start to finish - A six-step  guide

Writing from start to finish - A six-step guide

... without any research at all But research can make a dull story come to life—it can add vivid details and make it more believable I N AT I WRIT I NG AG VE IM Image Not Available 16 Carry a notebook ... idea there Eventually they all add up Here are four foolproof ways to get some words down on that blank page: Even a dumb idea can lead to a better idea making a list; making a cluster diagram; ... anything that comes into your head about it Making a cluster diagram I Another way of making a list is to it in the form of a cluster diagram Instead of having the assignment at the top of the page,...

Ngày tải lên: 18/12/2013, 18:12

225 463 2
Tài liệu FROM DESIGN TO DEPLOYMENT: A PRACTICAL GUIDE TO FTTX INFRASTRUCTURE ppt

Tài liệu FROM DESIGN TO DEPLOYMENT: A PRACTICAL GUIDE TO FTTX INFRASTRUCTURE ppt

... much larger overall uniformity Tolerance stack-up issues also impact the cascaded splitter approach, similar to the stack-up issues related to mechanical assemblies In a centralized approach, ... high take rate area, a cascaded splitter approach may make more sense In this case, there would be no requirement to have a wider reach and OLT cards could www.adc.com 41 42 Chapter — Advantage ... are readily available today and represent a natural evolution to more applications and better utilization of the copper plants But this is considered to be an intermediate solution, due to rate...

Ngày tải lên: 20/12/2013, 22:15

164 543 1
Tài liệu Adopting a Rescue Dog - The First Seven Days From Shelter to Home pdf

Tài liệu Adopting a Rescue Dog - The First Seven Days From Shelter to Home pdf

... as to try to train him effectively, to deal with it He was already crate-trained, and trained to fetch and return balls and Frisbees We actually kept the name he had at the shelter - Finnegan ... get me started on flexileashes, if you don’t understand why it is a bad idea you may want to think about adopting a gold fish Collar and ID Tag You won’t be able to purchase a collar and tag for ... Ceramic bowls are available 23 24 Adopting a Rescue Dog in many designs and are often more attractive The drawbacks are that they are usually more expensive, and they break easily Bed There are...

Ngày tải lên: 16/02/2014, 07:20

107 326 0
Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf

Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf

... the great men of his time Among those friends was Lord Chatham It was twenty years after Allen's death that Palmer's Mail Coach system was started Its advantage soon made itself apparent, and the ... have (sic) been pleased to order that a trial shall be made upon the road between London and Bristol, to commence at each place on Monday, August next, and that the mails should be made up at ... success apparent than troubles commenced, as may be gathered from the following paragraph, dated September 9, 1784:—"Bath We hear that the contractors for carrying the mail to and from this city and...

Ngày tải lên: 17/02/2014, 02:20

158 674 0
Tài liệu Transfer of Skills from Spanish to English: A Study of Young Learners doc

Tài liệu Transfer of Skills from Spanish to English: A Study of Young Learners doc

... FIFTH WAVE OF DATA After collecting an additional year of data, we will examine the data with a different analytical approach—structural equation modeling The advantage of this approach is that it ... grade Thus, the authors conclude that basic interpersonal communication skills acquired in one language not appear to transfer to a second language, whereas skills that are academically mediated ... researchers to suggest that native-language (Spanish) phonological awareness training could facilitate children’s ability to read in English ORTHOGRAPHIC SKILLS Fashola and colleagues (1996) examined...

Ngày tải lên: 24/02/2014, 18:20

29 647 0
Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt

Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt

... words are generated with respect to the partially tagged character sequence A character tagged with B always occurs at the beginning of a possible word Table illustrates the constrained and raw ... that maps a character-tag pair to a high-dimensional feature space, with respect to an input character sequence c For a possible word over c of length l , wi = ci0 ci0 +l−1 , tag each character ... 47th Annual Meeting of the ACL and the 4th International Joint Conference on Natural Language Processing of the AFNLP, ACL ’09, pages 513–521 Mitch Marcus, Beatrice Santorini, and Mary Ann Marcinkiewicz...

Ngày tải lên: 07/03/2014, 18:20

9 425 0
Be A Leader for God’s Sake -- From values to behaviors doc

Be A Leader for God’s Sake -- From values to behaviors doc

... self-interests and that they will only engage in activities that are personally profitable What a marked contrast to agapao leadership Another layer to the leader-follower relationship was created by ... God’s Sake Chapter 3: The Value of Caring for Employees/Followers I used to see The Beatitudes as separate elements or factors of agapao leadership Each value had an equal weight But as I have taught ... to recuperate without fear of additional economic loss There are many ways to demonstrate sacrificial love for employees Caring About Payroll Before I began my journey to become an agapao leader,...

Ngày tải lên: 07/03/2014, 19:20

199 458 0
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

... (such as the vocalic nucleus of a syllable) Where it appears natural to so, units on certain phonological tiers are also linked to right domain edges (ms is the case with phrase and boundary tone ... collapsed representation economical and relatively transparent We note in passing that although collapsing multilinear data-structures onto a single tier increases the likeliness of combinatorial ... between intonational phra~ses (IP), are inserted by the generator in between words and these T and B are then mapped to GToBI labels (German Tones and Break Indices- (Grice et al 96)) or discarded...

Ngày tải lên: 08/03/2014, 06:20

5 498 0
HUMAN PAPILLOMAVIRUS AND RELATED DISEASES – FROM BENCH TO BEDSIDE A DIAGNOSTIC AND PREVENTIVE PERSPECTIVE potx

HUMAN PAPILLOMAVIRUS AND RELATED DISEASES – FROM BENCH TO BEDSIDE A DIAGNOSTIC AND PREVENTIVE PERSPECTIVE potx

... Arrabal-Polo, Miguel Arrabal-Martin, Sergio Merino-Salas, Fernando López-Carmona Pintado, Salvador Arias-Santiago, Jacinto Orgaz-Molina, Maria Sierra Giron-Prieto, Santiago Melón, Mar a De O a, ... Girón-Prieto, Jacinto Orgaz-Molina, Sergio Merino-Salas, Fernando Lopez-Carmona Pintado, Miguel Arrabal-Martin and Salvador Arias-Santiago Chapter Human Papillomavirus Infection and Penile Cancer: Past, ... Papillomavirus 27 Angela Adamski da Silva Reis, Daniela de Melo e Silva, Cláudio Carlos da Silva and Aparecido Divino da Cruz Chapter HPV Diagnosis in Vaccination Era 57 Fátima Galán-Sánchez and Manuel Rodríguez-Iglesias...

Ngày tải lên: 08/03/2014, 19:20

334 4,7K 0
w