a neglected essential element of the pancreas

Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

... on the other hand, shows the magnitude of the trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel ... singularities The shrinkage procedure makes the class covariances closer to the overall data covariance, and therefore to each other, thus making the quadratic boundary more similar to a linear boundary ... γ is the regularization parameter, tr[·] is the trace function, and d is the dimension of the data vector After carrying out the regularization and shrinkage on the estimated covariance matrices,...

Ngày tải lên: 20/02/2014, 05:20

6 551 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... Onion arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan consists of 86% D-galactose and 6.6% L-arabinose, while soy arabinogalactan ... characterization of GALA Hydrolysis of arabinogalactans To obtain an A niger transformant that produces increased levels of b-1,4-endogalactanase, a construct was made in which galA was fused to the ... b-1,4-endogalactanases reported release of D-galactose and D-galactobiose from arabinogalactan, after initial release of D-galactotriose and D-galactotetraose [10,12,36,39] However, none of these papers...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Indoor Air Pollution Associated with Household Fuel Use in India: An exposure assessment and modeling exercise in rural districts of Andhra Pradesh, India doc

Indoor Air Pollution Associated with Household Fuel Use in India: An exposure assessment and modeling exercise in rural districts of Andhra Pradesh, India doc

... us the programmable pumps used in monitoring the households The authors of this report are Kalpana Balakrishnan, Sumi Mehta, Priti Kumar, Padmavathi Ramaswamy Sankar Sambandam, Satish Kumar K and ... Bank team included Sameer Akbar, Sadaf Alam, Uma Balasubramanian, Douglas F Barnes, Masami Kojima, Priti Kumar, and Kseniya Lvovsky (Task Team Leader) The team provided support in the design and ... Table A6 .3 Table A6 .4 Table A6 .5 Table A6 .6 Table A6 .7 Table A6 .8 Summary of kitchen area concentrations Summary of living area concentrations Analysis of variance: ln (kitchen area concentration)...

Ngày tải lên: 06/03/2014, 16:20

114 415 0
Báo cáo khoa học: Enzymatic characterization and molecular modeling of an evolutionarily interesting fungal b-N-acetylhexosaminidase pot

Báo cáo khoa học: Enzymatic characterization and molecular modeling of an evolutionarily interesting fungal b-N-acetylhexosaminidase pot

... identify the classical TATA box sequences, a promoter region containing two TATA box-like sequences (TAAATA and TAAATT) is located approximately 100 bp upstream from the ATG initiation codon The start ... (maximum); at higher temperatures, there was a rapid decrease in activity The PoHex activity was affected by salts (NH4)2SO4 and MgSO4 decreased the b-GlcNAcase activity, but b-GalNAcase activity was ... of the C-alpha atoms of Ala452-Asn462 and Gly469-Thr472 from the long loop moved by more than 0.3 nm Most (83.5%) of the amino acid residues are plotted in the favourable regions of the Ramachandran...

Ngày tải lên: 14/03/2014, 23:20

16 429 0
Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

... 5'-CACTCCATGGATGGCGG ATAAAAAAAATTTAGCC and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order ... sequences at the residues 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the ... interrupt the viral membrane to adhere to the viral materials, which eventually led to the abrogated formation of spherical membranes A small portion of the abnormal IV particles was able to mature into...

Ngày tải lên: 18/06/2014, 18:20

6 397 0
Báo cáo sinh học: " Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model Linda Petrone1, Maria G Ammendolia2, Armando" ppt

Báo cáo sinh học: " Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model Linda Petrone1, Maria G Ammendolia2, Armando" ppt

... Italy Authors’ contributions LP carried out the biochemical and immunological assays, made contribution to the analysis and interpretation of the data and helped to draft the manuscript; MGA carried ... interpreted the data and drafted the manuscript All authors read and approved the final manuscript Authors’ information LP’s present address: Istituto Nazionale Malattie Infettive “L Spallanzani”, ... HR-ICP-MS is a well established and powerful analytical technique for the determination of trace and ultra-trace elements in biological samples The calibration of the method was performed by the adoption...

Ngày tải lên: 18/06/2014, 19:20

9 276 0
Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

... 5'-CACTCCATGGATGGCGG ATAAAAAAAATTTAGCC and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order ... sequences at the residues 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the ... interrupt the viral membrane to adhere to the viral materials, which eventually led to the abrogated formation of spherical membranes A small portion of the abnormal IV particles was able to mature into...

Ngày tải lên: 20/06/2014, 01:20

6 401 0
báo cáo hóa học:" Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model" doc

báo cáo hóa học:" Recombinant HPV16 E7 assembled into particles induces an immune response and specific tumour protection administered without adjuvant in an animal model" doc

... Italy Authors’ contributions LP carried out the biochemical and immunological assays, made contribution to the analysis and interpretation of the data and helped to draft the manuscript; MGA carried ... interpreted the data and drafted the manuscript All authors read and approved the final manuscript Authors’ information LP’s present address: Istituto Nazionale Malattie Infettive “L Spallanzani”, ... HR-ICP-MS is a well established and powerful analytical technique for the determination of trace and ultra-trace elements in biological samples The calibration of the method was performed by the adoption...

Ngày tải lên: 20/06/2014, 03:20

9 308 0
Báo cáo hóa học: " Dance-the-Music: an educational platform for the modeling, recognition and audiovisual monitoring of dance steps using spatiotemporal motion templates EURASIP Journal on Advances in Signal Processing 2012," doc

Báo cáo hóa học: " Dance-the-Music: an educational platform for the modeling, recognition and audiovisual monitoring of dance steps using spatiotemporal motion templates EURASIP Journal on Advances in Signal Processing 2012," doc

... the same tempo However, as many databases as one pleases can be created varying with respect to the amount of dance steps and tempi These databases can then be stored as txt files and loaded again ... The display visualizes each dance step of a basic step model in a separate window Figure shows the graphical notation of an eight-step basic samba figure as performed by the samba teacher of the ... commercial market that provide mostly a fixed, built-in vocabulary of dance moves and music and also provide only a small action space Because of its dynamic character, the Dance -the- Music can also have...

Ngày tải lên: 21/06/2014, 19:20

42 325 0
Báo cáo hóa học: " An Improved Algorithm for the Piecewise-Smooth Mumford and Shah Model in Image Segmentation" docx

Báo cáo hóa học: " An Improved Algorithm for the Piecewise-Smooth Mumford and Shah Model in Image Segmentation" docx

... iterations taken to reach an essentially state In Figure we show a heart image where the classical algorithm fails to stop at the correct boundaries, thus, our algorithm can better on this kind of ... faster than classical one; moreover, it can work better on some highly noisy images that the classical algorithms fail to convergence Like the Chan-Vese approach, however, there are a few parameters ... Segmenting of a blood vessel image: (a) by the improved algorithm with 610 iterations and (b) by the original algorithm with 2320 iterations curves which are a distance τ apart, that is, the two...

Ngày tải lên: 22/06/2014, 22:20

5 383 0
RETINOBLASTOMA – AN UPDATE ON CLINICAL, GENETIC COUNSELING, EPIDEMIOLOGY AND MOLECULAR TUMOR doc

RETINOBLASTOMA – AN UPDATE ON CLINICAL, GENETIC COUNSELING, EPIDEMIOLOGY AND MOLECULAR TUMOR doc

... Govindasamy Kumaramanickavel Research Director, Narayana Nethralaya, Bangalore, Advisor - Research, Academics and Management, Aditya Jyot Eye Hospital, Mumbai India Visiting Associate, Ophthalmic ... 0.015) The median survival after the diagnosis of an intracranial tumor was months regardless of the location of the intracranial tumor For patients who received no treatment for the intracranial ... disease is unilateral (non hereditary) and the median age at diagnosis is two years Retinoblastoma is bilateral (hereditary) in about 40% of cases with a median age at diagnosis of one year-1...

Ngày tải lên: 27/06/2014, 09:20

180 252 0
Báo cáo khoa hoc:" An expression of mixed animal model means equations to account for different and variances in the base" pps

Báo cáo khoa hoc:" An expression of mixed animal model means equations to account for different and variances in the base" pps

... is altered and, in particular, it is no longer valid to assume that the breeding values of the base animals have the same mean and variance, and that the genetic variance of the base generation ... are The calculation of G is simplified if all the groups are assumed to have * the same additive genetic variance, and base animals are unrelated and non1 * inbred, because in that case Gis the ... a and a respectively The vector of breeding values of non-base animals can be partitioned as: * where s is a linear transformation of the random vector of the Mendelian sampling effects (s) of...

Ngày tải lên: 09/08/2014, 18:21

9 397 0
báo cáo khoa học: "An evidence-based health workforce model for primary and community care" pot

báo cáo khoa học: "An evidence-based health workforce model for primary and community care" pot

... 23 Australian Institute of Health and Welfare (AIHW): Cardiovascular disease: Australian facts 2011 [Cat No CVD 53] Canberra, Australia: AIHW; 2011 24 Enzlin P, Mathieu C, Van den Bruel A, Vanderschueren ... health advisor, South Australian Department of Health), and Professor Esther May (Dean of Health and Clinical Education, University of South Australia) This project is funded by an Australian ... cross-disciplinary panels of clinicians working with patients with diabetes in Metropolitan Adelaide (South Australia) or the regional center of Whyalla (South Australia) The aim was to identify additional...

Ngày tải lên: 10/08/2014, 11:20

8 263 0
báo cáo khoa học: " Improving quality of care through routine, successful implementation of evidence-based practice at the bedside: an organizational case study protocol using the Pettigrew and Whipp model of strategic change" potx

báo cáo khoa học: " Improving quality of care through routine, successful implementation of evidence-based practice at the bedside: an organizational case study protocol using the Pettigrew and Whipp model of strategic change" potx

... environmental pressure; good managerial and clinical relations; co-operative interorganizational networks; a fit between the change agenda and its locale; and the simplicity and clarity of organizational ... between the hospitals or emphasize the actual status of an individual site Analyses Data from this multi-method study will be summarized and compared to answer the study's analytical and operational ... relevant research has recognized that the process of implementation most often takes place within an organizational context that can have either a facilitative or hin- dering impact upon the adoption...

Ngày tải lên: 11/08/2014, 05:22

13 424 0
Báo cáo y học: " Dimensional and hierarchical models of depression using the Beck Depression Inventory-II in an Arab college student sample" pot

Báo cáo y học: " Dimensional and hierarchical models of depression using the Beck Depression Inventory-II in an Arab college student sample" pot

... Kuwait Authors’ contributions FAA conceived the study and supervised collection of data FAA and JUO designed the study and analyzed the data FAA and JUO drafted the manuscript All authors read and ... scores are calculated: the total score is the average of all 25 Page of 14 items; the anxiety score is the average of the 10 anxiety items; while the depression score is the average of the 15 ... in data analysis Joy Wilson coded some of the data We thank Charles Osuagwu and Ramani Varghese for their role in locating literature Author details Department of Psychology, College of Education,...

Ngày tải lên: 11/08/2014, 16:22

14 381 0
Báo cáo y học: "Violence and post-traumatic stress disorder in Sao Paulo and Rio de Janeiro, Brazil: the protocol for an epidemiological and genetic survey" ppt

Báo cáo y học: "Violence and post-traumatic stress disorder in Sao Paulo and Rio de Janeiro, Brazil: the protocol for an epidemiological and genetic survey" ppt

... literacy levels These measures have been estimated for each district using the available data from the Sao Paulo State Data Analysis System Foundation (SEADE) [35] and the Brazilian Institute of ... data management team The data was extracted into SPSS format, and the database cleaning, processing of the CIDI 2.1 algorithms and derived variables were performed DNA extraction: the DNA extraction ... classification of mental disorder according to the International Classification of Diseases, 10th edition (IDC-10), and the Diagnostic and Statistical Manual of the American Psychiatric Association,...

Ngày tải lên: 11/08/2014, 17:20

9 367 0
Báo cáo y học: " Successful treatment of Candida parapsilosis and Pseudomonas aeruginosa infection using medical and surgical management in an injecting drug user with mitral and aortic valve endocarditis: a case report" doc

Báo cáo y học: " Successful treatment of Candida parapsilosis and Pseudomonas aeruginosa infection using medical and surgical management in an injecting drug user with mitral and aortic valve endocarditis: a case report" doc

... department of our hospital, and was found to have Candida parapsilosis and Pseudomonas aeruginosa endocarditis A 2D echocardiogram was done there and showed vegetation of the prosthetic mitral ... albicans candida accounts for another 24% of the fungal isolates [6, 7] The difficulty arises in the management of these cases, especially with the growing resistance to the usual combination antibiotics ... mitral valve vegetation attached to the anterior leaflet without significant regurgitation The hospital course was complicated by acute renal failure and acute heart failure for which the patient...

Ngày tải lên: 11/08/2014, 17:21

3 305 1
Báo cáo sinh học: " Genetic profiles from coat genes of natural Balearic cat populations: an eastern Mediterranean and North-African origin" pot

Báo cáo sinh học: " Genetic profiles from coat genes of natural Balearic cat populations: an eastern Mediterranean and North-African origin" pot

... (Sokal and Oden, 1978ab; Sokal and Wartemberg, 1983) Spatial autocorrelation is the dependence of the value of a particular variable at location on the value of that same variable at other nearby ... populations analysis The Balearic cat populations on are clearly and significantly more related to the North-African and eastern Mediterranean cat populations, and to the Catalonian cat populations ... Tarragona (Catalonia) and Argolis (Greece) All the Catalonian populations also appear together with eastern Mediterranean and North-African populations On the other hand, the Spanish Levante populations...

Ngày tải lên: 14/08/2014, 19:22

26 201 0
w