a natural phenomenon of secondary metabolism regulation

Molecular Biology of Secondary Metabolism - Case Study for Glycyrrhiza Plants

Molecular Biology of Secondary Metabolism - Case Study for Glycyrrhiza Plants

... in aerial part of American alfalfa, Medicago sativa L The structure of dehydrosoyasaponin I Yakugaku Zasshi 108: 547–554 Kitagawa, I., Hori, K., Taniyama, T., Zhou, J.L., Yoshikawa, M 199 3a Saponin ... H Hayashi (B) School of Pharmacy, Iwate Medical University, 2-1-1 Nishitokuta, Yahaba, Iwate 028-3603, Japan e-mail: hhayashi@iwate-med.ac.jp A Kirakosyan, P.B Kaufman, Recent Advances in Plant ... treated with yeast extract (Hayashi et al., 2003) 100 H Hayashi Fig 5.9 Seasonal variation of accumulation of β-amyrin synthase (bAS) and cycloaretenol synthase (CAS) mRNAs in thickened main...

Ngày tải lên: 25/10/2013, 05:20

33 614 1
The Natural Functions of Secondary Metabolites

The Natural Functions of Secondary Metabolites

... 38 A. L Demain · A Fang 181 Sakurai S, Tamura S, Yanagishima N, Shimoda C (1977) Agric Biol Chem 41:395 182 Kamiya M, Sakurai A, Tamura S, Takahashi N, Abe K, Tsuchiya E, Fukui S (1978) Agric Biol ... between bacteria is also effected via antibiotics Agrocin 84, a plasmid-coded antibiotic of Agrobacterium rhizogenes, is an adenine derivative which attacks strains of plant pathogenic agrobacteria ... Achyla, antheridol, a steroidal secondary metabolite, is produced by vegetative female mycelia and initiates the formation of male gametangia The compound is active at concentrations as low as...

Ngày tải lên: 26/10/2013, 02:20

39 605 0
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... was amplied by PCR from genomic DNA using the sense primer 5Â-AAGCTTATGTCAACACGACGACTTATGCAC A- 3Â and the antisense primer 5Â-GGATCCGGATCCTT AAGCCGTTCCCTGTTC-3Â with additional HindIII and BamHI ... Implications for parasite chemotherapy Mammalian cells maintain a repertoire of four pathways for metabolism of methylglyoxal [33], whereas our studies suggest that the African trypanosome may be solely ... not maintain an intact glyoxalase system, and may metabolize methylglyoxal via methylglyoxal reductase (MeGR) and lactaldehyde dehydrogenase (LADH) to L-lactate Solid lines: conrmed metabolism...

Ngày tải lên: 23/03/2014, 06:20

11 640 0
the nothing that is, a natural history of zero - robert kaplan

the nothing that is, a natural history of zero - robert kaplan

... vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that's 1031), and so through the alluring samaptalambha (1037) and the tongue-twisting visandjnagati (1047) to tallakchana (107 ... must name all the numerical ranks beyond a koti (ten million, i.e., 107), each rank being a hundred times greater than the last Gautama answers: ayuta, niyuta, karikara, vivara, achobya, vivaha, ... Oda, Larry Pfaff, Donald Ranee, Andrew Ranicki, Aamir Rehman, Abdulhamid Sabra, Brian A Sullivan, Daniel Tenney III, Alf van der Poorten, Jared Wunsch, Michio Yano and Don Zagier Finally, I can't...

Ngày tải lên: 05/06/2014, 11:23

238 5,2K 0
FloodsFloodsFloods are a natural phenomenon. pdf

FloodsFloodsFloods are a natural phenomenon. pdf

... Floods are natural calamities and occur regularly in certain low lying area The unexpected flood causes great misery The rush of water demolishes houses and destroys homes It inundates large areas ... cultivation, wrecks public services and makes the life of the survivors miserable Sometimes man is prepared for it and has learned to take advantage of floods to enrich their soil, trap fish and ... logs of wood Floods, however have always brought out the best in men Men organize rescue and relief activities for strangers without expectation of personal gain Voluntary organizations organize...

Ngày tải lên: 21/07/2014, 20:20

5 225 0
Báo cáo lâm nghiệp: " Mating system parameters in a natural population of Abies borisii regis Mattfeld" pdf

Báo cáo lâm nghiệp: " Mating system parameters in a natural population of Abies borisii regis Mattfeld" pdf

... which is a limitation for intercrossing, similar val= recorded for other Abies: A alba, = 0.89 (Schroeder, 1989); A lasiocarpa, m t m t 0.89 (Shea, 1987); A balsamea, t m 0.89 (Neale and Adams, 1985) ... dissertation, Oregon State University Ncale DB, Adams WT ( 1981 ) Inheritance of isozyme variants in seed tissues of balsam fir (Abies balsamea) Can J Bot 59, 1285-1291 Neale DB, Adams WT (1985) Allozyme ... Allozyme and matingsystem variation in balsam fir (Abies balsamea) across a continuous elevational transect Can J Bot 63, 2448-2453 Ritland K (1986) Joint maximum likelihood estimation of genetic and...

Ngày tải lên: 08/08/2014, 18:21

5 234 0
Báo cáo y học: "iagnostic Markers based on a Computational Model of Lipoprotein Metabolism" ppsx

Báo cáo y học: "iagnostic Markers based on a Computational Model of Lipoprotein Metabolism" ppsx

... ratios as predictors of cardiovascular disease in a separate study To this end we will analyze relevant data from cohorts such as the Framingham Heart Study Developing a similar approach to Particle ... Average particle HL attachment rate LDL day-1 0.026 N.S Average particle HL attachment rate VLDL2 day-1 0.034 N.S Average particle lipolysis rate LDL Size and age parameters Average particle age LDL ... ben.vanommen@tno.nl APF: a. freidig@amtbiopharma.com JvdG: jan.vandergreef@tno.nl AAdG: albert.degraaf@tno.nl -1- Abstract Background Dyslipidemia is an important risk factor for cardiovascular...

Ngày tải lên: 10/08/2014, 09:22

41 405 0
báo cáo khoa học: " Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris" doc

báo cáo khoa học: " Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris" doc

... Department of Biology and Wildlife, University of Alaska at Fairbanks, Fairbanks, AK 99775, USA 3Institute of Arctic Biology, University of Alaska at Fairbanks, P.O Box 757000, Fairbanks, AK ... the cox1 gene and internal primers were developed to sequence the atp1 gene (AtpA297F: TCGACGTGTCGAAGTGAAAG; AtpA1170R: TCTGAGCCAAATTGAGCAAA) DNA nucleotide sequences of the cox1 and atp1 coding ... among 331 offspring is comparable to 4% of nonmaternal offspring revealed among 318 S vulgaris plants by [22] Rare paternal inheritance (1.9%) of mt markers in a natural population of S vulgaris...

Ngày tải lên: 12/08/2014, 03:21

11 163 0
Báo cáo y học: " A mathematical model of glutathione metabolism" pps

Báo cáo y học: " A mathematical model of glutathione metabolism" pps

... Figure One-carbon metabolism and the transsulfuration pathway One-carbon metabolism and the transsulfuration pathway Rectangles enclose the names or acronyms of substrates that are variables in ... Pino MM, Ruiz F, Castro C, Garcia-Trevijano ER, Latasa U, Martinez-Chantar ML, Martinez-Cruz A, Avila MA, Mato JM: Regulation of mammalian liver methionine adenosyltransferase J Nutr 2002, 132:2377S-2381S ... submitted manuscript Additional material 14 15 16 17 Additional file Supplementary Material – Model Details for A Mathematical Model of Glutathione Metabolism A full description of the mathematical model...

Ngày tải lên: 13/08/2014, 16:21

16 358 0
Báo cáo sinh học: "Association among quantitative, chromosomal and enzymatic traits in a natural population of Drosophila melanogaster" pptx

Báo cáo sinh học: "Association among quantitative, chromosomal and enzymatic traits in a natural population of Drosophila melanogaster" pptx

... outstanding features of natural southern and northern populations of the species for these same characters MATERIALS AND METHODS A sample of 359 males and 259 females of Drosophila melanogasterwas ... Drosophila melanoto latitude, season, wing-loading Tantawy AO, Mallah GS (1961) Studies on natural population of Drosophila I Heat resistance and geographical variation in Drosophila melanogaster and D ... D melanogaster J Genet 50, 414-448 Ruiz A, Santos M, Barbadilla A, Quezada-Diaz JE, Hasson E, Fontdevila A (1991) Genetic variance for body size in a natural population of Drosophila buzzatii...

Ngày tải lên: 14/08/2014, 19:22

20 350 0
Báo cáo sinh học: "Seasonal fluctuations of cosmopolitan inversion frequencies in a natural population of Drosophila melanogaster" pot

Báo cáo sinh học: "Seasonal fluctuations of cosmopolitan inversion frequencies in a natural population of Drosophila melanogaster" pot

... Japanese natural populations of Drosophila melanogaster Jpn J Genet 54, 69-82 Inoue Y, Watanabe T, Watanabe TK (1984) Evolutionary change of the chromosomal polymorphism in Drosophila melanogaster ... individually in vials, and salivary gland chromosomes from a single larva of the progeny of each vial were examined Chromosomes were prepared as described by Levine and Schwartz (1970) Because of data ... due to the small scale of sampling (Anderson et al, 1987) The parallel chromosomal changes with latitude suggest an adaptation to ecological differences associated with climate (explanations involving...

Ngày tải lên: 14/08/2014, 20:20

10 199 0
Carpets monsters and killer spores: a natural history of toxic mold

Carpets monsters and killer spores: a natural history of toxic mold

... but none of this had captured my interest until a black mold attacked my wife I had bought Diana a gift box of hand lotion, soap, and lip balm that trumpeted an all -natural, no-preservative pedigree ... is easy to be mistaken about the cause of a discolored area in a house, because spores of other fungi floating in the air may contaminate the sample and may be better at growing on agar than the ... species that may someday replace Stachybotrys & Company as the new menace, a cash cow for the legal profession and a bane of insurers These beasts will be featured in the final chapter The target audience...

Ngày tải lên: 27/05/2016, 00:05

191 330 0
Báo cáo khoa học: " Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. I. Spatial variation" pot

Báo cáo khoa học: " Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. I. Spatial variation" pot

... concentric bands on a comparatively dark background (figs 4A, B) These bands were paratracheal axial parenchyma of the confluent type In general, band spacing varied gradually, increasing and decreasing ... also have had repercussions on wood formation, especially the lack of rainfall, as in the wood of Carya glabra where the spacing of tangential parenchyma bands is related to the rate of rainfall ... occurrence of parenchyma bands In this area, parenchyma cells changed from a radially flattened type to a radially dilated type - more precisely from a rather narrow area to a wider area in cross...

Ngày tải lên: 08/08/2014, 23:22

14 434 0
Báo cáo khoa học: "Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. II. Terminal growth, lateral growth and main stem-branch growth correlations" ppsx

Báo cáo khoa học: "Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. II. Terminal growth, lateral growth and main stem-branch growth correlations" ppsx

... mean diameter of axes was measured with a calliper rule: main stems at cm above and below each tier, and different branches at the base a tape A complete set of data was collected for each of the ... described, ie the appearance of axillary shoots and dynamics of branching, as well as radial growth of both main stems and branches In addition, one occurrence of main stem reiteration is described ... favorable À la fin de la grande saison sèche, il n a pas pu être observé de façon aussi manifeste, puisque la croissance caulinaire pouvait être arrêtée pendant ou semaines et que la croissance...

Ngày tải lên: 08/08/2014, 23:22

20 448 0
báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot

báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot

... carcinoma cells Anticancer Drugs 2003, 14:193-202 103 Yagi Y, Fushida S, Harada S, Kinoshita J, Makino I, Oyama K, Tajima H, Fujita H, Takamura H, Ninomiya I, Fujimura T, Ohta T, Yashiro M, Hirakawa ... Clark A, Pradhan S, Jacobsen SE: UHRF1 plays a role in maintaining DNA methylation in mammalian cells Science 2007, 317:1760-1764 Sharif J, Muto M, Takebayashi S, Suetake I, Iwamatsu A, Endo TA, ... possibility that numerous other natural compounds can take the same pathways leading to apoptosis apoptosis in colorectal cancer by activation of p53 and p73 which are negative upstream regulators of UHRF1...

Ngày tải lên: 10/08/2014, 10:21

10 414 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

... if air looses enthalpy, water would be heated Thus, in a process where air and water are in contact, water will always tend to adiabatic saturation temperature, as in the case of the adiabatic ... output of the tunnel, if water is provided and evaporated at that temperature Isolation Non-saturated air Saturated state had sat = h1 Tad sat RH = 100 % T1 RH1/ h1 Isolation Water suppy at Tad sat ... recirculated to maintain its temperature at the adiabatic saturation temperature of inlet air Because the sensible heat load is transferred to the water surface and transformed into evaporation latent...

Ngày tải lên: 05/09/2013, 16:10

28 653 0
Tài liệu Báo cáo " A new natural source of Camphor from Cinnamomum longepetiolatum Costerm. apud Phamh. in Vietnam " doc

Tài liệu Báo cáo " A new natural source of Camphor from Cinnamomum longepetiolatum Costerm. apud Phamh. in Vietnam " doc

... phytochemical works have been recorded for the C longepetiolatum Costerm apud Phamh found in Vietnam As a part of the research on the essential oils of Medicinal and Aromatic plants of the Vietnam flora, ... Preparation Flora of China Vol (Berberidaceae through Capparaceae) Science Press, Beijing, and Missouri Botanical Garden Press, St Louis [3] Vietnamese Pharmacopoeia, Medical Publishing House, Hanoi, ... G.W .A Milne, EPA/NIH Mass Spectral Data Base, U.S Government Printing Office, Washington D.C., 1978, 1980, 1983 [5] E Stenhagen, A Abrahamsson, F.W McLafferty, Registry of Mass Spectral Data,...

Ngày tải lên: 12/02/2014, 17:20

4 403 0
Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

... information about the semantic structure of concepts associated with English words, particularly verbs For example, the verb abridge has an associated case frame consisting of an agent doing the abridging ... straightforward, and the resulting complex of resources executes without any performance problems in a multi-user environment The task of a developer of a particular natural language application is greatly ... client-server architecture, for use with a general-purpose natural language understanding system The conversion of resources such as Comlex and WordNet into a format usable by our system was straightforward,...

Ngày tải lên: 20/02/2014, 18:20

5 417 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf

... of a transient nature Our data suggest a sequential model of signaling in which CD95 receptor activation generates early signals at the plasma membrane that lead to the translocation of nuclear ... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... require an activation loop involving active caspase-8 Discussion FADD is an essential adaptor protein in the CD95mediated apoptotic signaling cascade that couples activated receptors with the activation...

Ngày tải lên: 07/03/2014, 02:20

10 483 0
w