a multiscale heart simulation on massively parallel computers

Ngày tải lên: 24/03/2014, 02:20

Ngày tải lên: 20/06/2014, 04:20

Ngày tải lên: 11/08/2014, 12:21

... Bộ sản phẩm flashcard blueup IELTS bao gồm 1100 từ vựng, chia thành 11 bộ khác nhau thuộc bộ từ “Cambridge Vocabulary for IELTS” c a Pauline Cullen. B a IELTS 1 www.blueup.vn B a TOEIC2 Giới ... phẩm flashcard blueup TOEFL iBT bao gồm 1500 từ vựng, chia thành 15 bộ khác nhau thuộc bộ từ “TOEFL iBT Exam Vocabulary List” c a Michael Buckhoff. B a TOEFL iBT 1 bạn đồng hành thú vị c a bạn ... liên lạc 43 Vĩnh Nam, Phường 11, Quận 8, Tp HCM (+84) 66 60 68 65 talk@blueup.vn Flashcard blueup – A bit of English on your journey! Flashcard là phương pháp học từ vựng tiếng Anh rất hiệu quả....

Ngày tải lên: 02/10/2012, 12:02

... outw ustrates a dem axation times [ ster@-BioShut g concentration g tomographic cal concentra graphical sign @C 80n as a carg a conjugate 4 consisting the transfe r cell membran an address se cellular ... Publisher. All rights reserved Research Paper Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer ... images T1 relaxation times were calculated by a non-linear fit (Leven- berg-Marquardt algorithm) of the signal amplitudes using the exponential saturation recovery relation- ship. In the MDA-MB-231...

Ngày tải lên: 26/10/2012, 09:07

... thức lượng trong giác vuông: AH 2 = AE.AB ( AHB vuông taïi H) AH 2 = AF.AC (  AHC vuoâng taïi H) Suy ra : AE.AB = AF.AC d) Yêu cầu HS chứng minh: * EF vuông góc với KF : Trang 2 Giáo viên ... nhau. b) Tứ giác AEHF là hình chữ nhật vì EÂF = A F = AFÂH = 90 0 c) { HS có thể chứng minh theo hai cách:} 1) 2  đồng dạng:  AEF  ACB, từ đó suy ra: ACAFABAE AB AF AC AE =⇔= 2) p ... theo định lí về hai tiếp tuyến cắt nhau, ta suy ra được điều gì ? + MAO là  gì? + MAO có đường cao AE nên suy ra được điều gì? Tương tự, ta có: MF.MO’ = MA 2 Suy ra: ME.MO = MF.MO’. *...

Ngày tải lên: 07/08/2013, 01:26

Ngày tải lên: 11/12/2013, 23:48

Ngày tải lên: 18/12/2013, 10:08

... type, an iterative solver such as the AMG (Algebraic Multi Grid) equation is a particular strength of the ANSYS Mechanical program. Moreover, the calculation can take advantage of parallel ... Using the Contact Manager to define interface attributes is easy and simple. The Contact Wizard (part of Contact Manager) guides allows one to pick a pair of target and contact surfaces, then ... chips, and other advances are partly a result of accurate and detailed analysis. Can one reliably simulate the collapse of a shell, interaction of multiple parts, behavior of a rubber seal,...

Ngày tải lên: 23/12/2013, 01:16

... Reliability Analysis of a Power System Based on the Multi-State System Theory Chunyang LI College of Mechatronics Engineering and Automation National University of Defense Technology Changsha, ... Changsha, 410073, China E-mail: lichunyang.nudt@163.com Xun CHEN, Xiaoshan YI College of Mechatronics Engineering and Automation National University of Defense Technology Changsha, 410073, China ... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh. Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are...

Ngày tải lên: 03/01/2014, 19:38

... varying conditions. First, they consider a situation in which each maintenance worker can fix only one type of part. In the second trial, they relax this condition and consider a situation in which ... from one standard deviation below the average CO tenure to one standard deviation above it (an increase from 6 to 21 months) leads to an increase in the time a ship is free of failures of about ... Jennifer_Kavanagh@rand.org. For more information on RAND's Forces and Resources Policy Center, contact the Director, Susan Everingham. She can be reached at the same address, by e-mail: susan_everingham@rand.org,...

Ngày tải lên: 17/02/2014, 22:20

... CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ⁄ W168F ⁄ Y74W TCA CCGGTCCATGATCCATT ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetics Unit, Jawaharlal ... in enzymes: a study of triosephosphate isomerase and comparison with methyl glyoxalsynthase. Adv Protein Chem 66, 315–372. 45 Gunasekaran K, Ramakrishnan C & Balaram P (1996) Disallowed Ramachandran...

Ngày tải lên: 18/02/2014, 11:20

...

Ngày tải lên: 19/02/2014, 03:20

... passive basis. Global Investment Solutions (GIS) covers asset allocation, currency, manager research and risk management. Our other investment and business areas are Alternative and Quantitative ... Estate) Mark Deans (Risk measurement and Derivatives) Matt Bance (Global tactical asset allocation and Currency) Neil Olympio (Asset allocation in the presence of liabilities) Paul Moy (Infrastructure ... division of UBS, is one of the world’s leading asset managers, providing a diverse range of traditional, alternative, real estate and infrastructure solutions to private clients, financial intermediaries...

Ngày tải lên: 19/02/2014, 14:20

... Rs.113/- Annual Fee (first year) No Charge Annual Fee (second year onwards) Rs.113/- Cash withdrawal from UBI ATMs ( No limit) No Charge Cash withdrawal from other Bank ATMs ( 5 per month ... 01.04.2012 5. Cancellation of Demand Drafts./Pay Orders (inclusive of service tax) Cancellation Charges of Demand Draft Rs.102/- per instrument. Cancellation Charges of Pay Orders Rs.102/- ... Processing Charge 1.Housing Loan Upto Rs. 25.00lac Above Rs 25 Lac & Upto Rs 30 LAC Above Rs 30 LAC and Upto Rs 75 lac Above Rs 75 Lac & upto Rs 150 Lac 0.5% Floating Category...

Ngày tải lên: 06/03/2014, 02:21

... international! ¿QDQFHIRUWURSLFDOIRUHVWSUHVHUYDWLRQ&RXQWULHVWU\LQJ to!move!fast !on! forest!preservation!and!climate!change! are!starting!to!look!at!bilateral!deals!whereby!public!funds! can!catalyse !a! sustainable!development!path!and!leverage! SULYDWHVHFWRU¿QDQFHWRVXSSRUWLW)RUHVWERQGVRIIHUD mechanis ... sts!has!received!increased! attention!in!recent!years,!particularly!through!interna\ tional!climate!change!negotiations!and!efforts!to!develop !a! mechanism!for!reducing!emissions!from!deforestation!and! forest!degradation!and!conserving,!sustainably!managing! and!enhancing!forest!carbon!stocks!(collectively!referred! to!as!REDD+).!One!recent!estimate!suggests!that!the!scale! RI¿QDQFLQJUHTXLUHGWRKDOYHGHIRUHVWDWLRQZLOOLQFUHDVH over!t ... s.! Policymaker s!that!support!carbon!markets!have!usually! done!so !on! the!basis!that!provid ing !a! price!signal!for!the! output!of!an!environmental!externality!would!cha nge!the! economic!landscape!and!force!the!private!sector!to!change! LWVEHKDYLRXU7KDWORJLFZRUNVLQVRPHFDVHVVSHFL¿FDOO\ when!the!exter...

Ngày tải lên: 06/03/2014, 04:21

... appropriate. See paragraphs 3.22 to 3.36 under ‘Cancellation rights’. This pre-contractual information and some additional information, outlined at paragraphs 3.1 and 3.10 must be confirmed ... information and guidance on all aspects of running a business. It also provides guidance on the ECRs. Trading Standards Advice on the law, local information and details of your nearest Trading Standards ... paragraph 3.64. Can I withhold a refund if a consumer fails to take reasonable care of the goods? 3.47 No. Other than for the exceptions at paragraph 3.38 the DSRs give consumers an unconditional...

Ngày tải lên: 07/03/2014, 08:20

... Koplan JP. Health literacy among medicare enrollees in a managed care organization. JAMA 1999; 281:545–51. [10] International Reading Association, Special Interest group on reading and readability. ... accompanied by a drawing showing a person carrying out that action along with a caption written at a second grade reading level. As a result, people who can understand writing at a second grade level ... health professionals may qualify statements and speak in broad generalizations to patients who want specific information that applies to them, personally. At the same time, patients are in a stressful environment...

Ngày tải lên: 14/03/2014, 21:20

... 5Â-GGTTCCCAGGGTGCATGAAA-3Â; antisense, 5Â-CACGTAGGGTGAATCCGTCAG-3Â; G6Pase: sense, 5Â-ATGAGTCTGGTTACTACAGCCA-3Â; antisense, 5Â- AAGACAGGGCCGTCATTATGG-3Â). All reactions were performed in triplicate and ... (Biorad Laboratories). Densitometric analysis Each band, when mentioned, was analysed by alpha digi- doc 1201 software (Alpha Innotech Corporation, San Leandro, CA, USA). The same sized rectangular ... on phosphoenolpyruvate carboxykinase gene expression and gluconeogenesis by altering the cellular localization of Foxa2 in HepG2 cells Amit K. Pandey, Vikash Bhardwaj* and Malabika Datta Institute of Genomics and...

Ngày tải lên: 16/03/2014, 02:20

... Sahaf, L. Masson, C. Leandri, B. Auffray, G. Le Lay, F. Ronci, Appl. Phys. Lett. 90 (2007) 263110. [3] M .A. Valbuena, J. Avila, M.E. Davila, C. Leandri, B. Aufray, G. Le Lay, M.C. Asensio, Appl. ... Letters One-dimensional organic nanostructures: A novel approach based on the selective adsorption of organic molecules on silicon nanowires Eric Salomon * , Antoine Kahn Department of Electrical ... the nanowires. In the latter case, chemisorption of suitable organic molecules on the nanowires leads to a well-defined one-dimensional aggregation and changes the metallic character of the nanowires...

Ngày tải lên: 16/03/2014, 15:35