a multifacet protein at the crossroad of inflammation and autoimmunity

Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx

Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx

Ngày tải lên : 19/02/2014, 18:20
... a- crystallin deamidation involves the nonenzymatic conversion of asparagine to either aspartate or isoaspartate, and glutamine becomes glutamic acid, prevalent changes during cataract formation and aging ... development of therapeutic applications such as the use of carnosine to disaggregate glycated a- crystallin [47] and employing agents that prevent post-translational changes [40] Cataract and a- crystallin ... modification before disease appears, and cataract associated protein changes may occur subsequent to lens a- crystallin denaturation rather than before [24,42] In spite of these observations, the...
  • 15
  • 573
  • 0
Báo cáo khoa học: Functional similarities between the small heat shock proteins Mycobacterium tuberculosis HSP 16.3 and human aB-crystallin docx

Báo cáo khoa học: Functional similarities between the small heat shock proteins Mycobacterium tuberculosis HSP 16.3 and human aB-crystallin docx

Ngày tải lên : 23/03/2014, 21:21
... 10 The sample was then centrifuged at 35 000 g for h at °C The supernatant was decanted and the insoluble pellet was discarded The supernatant was then ready for purification using the Pharmacia ... presence and absence of ATP on the aggregation of CS In the absence of added MTB HSP 16.3, aggregation of CS increased after a short delay to reach a maximum after approximately 25 at 45 °C Ó ... with and without ATP over a 30-min period The aggregation of CS was measured with the addition of different concentrations of MTB HSP 16.3 and in the presence or absence of ATP and ATP analogs (A) ...
  • 8
  • 310
  • 0
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

Ngày tải lên : 20/02/2014, 23:20
... in the appearance of an additional peak at 7.65 mL on the elution profile Increase of the temperature of incubation was accompanied by the simultaneous increase of the peak eluted at 7.65 mL and ... molecular mass 9–11 kDa may include subdomains and of actin After heating at 43 °C, actin turns into a state that is different from both the intact and denatured conformations This intermediate state ... mutant of HSP25 on the initial rate of actin polymerization can be explained by the prevention of nonspecific aggregation of partially denatured actin that can trap intact actin The 3D mutant...
  • 10
  • 431
  • 0
Báo cáo khóa học: Chaperone activity of cytosolic small heat shock proteins from wheat pptx

Báo cáo khóa học: Chaperone activity of cytosolic small heat shock proteins from wheat pptx

Ngày tải lên : 07/03/2014, 15:20
... (equivalent weight) in the initial heatinactivation step Data points and error bars reflect the mean and standard deviation of three replicates Results Comparison of TaHsp16.9 C-I and TaHsp17.8 C-II To ... luciferase reactivation assays Luc was heat-inactivated at 42 °C in the presence of sHsp as described for formation of sHsp/Luc complexes above Luc reactivation in reticulocyte lysate was assayed as ...  6.5 in most of the samples In total, as observed by light scattering, substrate denaturation and aggregation are time-dependent, the sHsps can be saturated with substrate, and TaHsp17.8C-II...
  • 11
  • 386
  • 0
Báo cáo khoa học: Temperature and concentration-controlled dynamics of rhizobial small heat shock proteins doc

Báo cáo khoa học: Temperature and concentration-controlled dynamics of rhizobial small heat shock proteins doc

Ngày tải lên : 23/03/2014, 12:20
... order to assess the quaternary changes associated with temperature, HspF (0.7 mgÆmL)1) was equilibrated at a range of temperatures prior to online analysis by nanoESI-MS At 14 °C, the ratio of 12mer ... chromatography, is shown (––) Protein from the control sample (B) and the heat-treated sample (C) was collected, precipitated, separated by SDS-PAGE and stained with Coomassie blue Lanes and correspond ... Kaneko, T., Nakamura, Y., Sato, S., Minamisawa, K., Uchiumi, T., Sasamoto, S., Watanabe, A. , Idesawa, K., Iriguchi, M., Kawashima, K., Kohara, M., Matsumoto, M., Shimpo, S., Tsuruoka, H., Wada,...
  • 10
  • 289
  • 0
Báo cáo khoa học: Mimicking phosphorylation of the small heat-shock protein aB-crystallin recruits the F-box protein FBX4 to nuclear SC35 speckles docx

Báo cáo khoa học: Mimicking phosphorylation of the small heat-shock protein aB-crystallin recruits the F-box protein FBX4 to nuclear SC35 speckles docx

Ngày tải lên : 23/03/2014, 13:20
... mutation in the aB-crystallin chaperone gene causes a desmin-related myopathy Nat Genet 20, 92–95 Sawada, K., Agata, K., Yoshiki, A & Eguchi, G (1993) A set of anti-crystallin monoclonal antibodies ... ethanol or an a1 -adrenergic antagonist J Biochem (Tokyo) 117, 1238–1243 Kato, K., Goto, S., Inaguma, Y., Hasegawa, K., Morishita, R & Asano, T (1994) Purification and characterization of a 20-kDa ... its localization is resistant to DNase I and RNase A, indicating that these mutants form a stable interaction with one or more speckle-associated proteins SC35 speckles are interchromatin granule...
  • 9
  • 381
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Ngày tải lên : 07/03/2014, 04:20
... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E19 0A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E19 0A, 5¢-CAAATTGGGGG ... 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E19 9A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E20 4A ... mutants precipitated out of solution within °C of the onset of precipitation at 68 °C for E19 0A and 70 °C for E19 9A and E20 4A and the small increase in light scattering at temperatures above approximately...
  • 14
  • 417
  • 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Ngày tải lên : 07/03/2014, 12:20
... 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ ... heat-induced inactivation better than mutated p26, and at 1200 nm the activity remaining was essentially the same as in unheated preparations (Fig 5D) R11 4A was the least effective of all p26 variants ... was determined by oversaturation with 1-anilino-8-naphthalene-sulphonate (ANS) Fluorescence was measured at an excitation wavelength of 388 nm and band pass of nm, with emission wavelength at...
  • 15
  • 515
  • 0
Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx

Báo cáo khoa học: Effect of mutations in the b5–b7 loop on the structure and properties of human small heat shock protein HSP22 (HspB8, H11) pptx

Ngày tải lên : 23/03/2014, 07:20
... and the supernatant was used as the starting material for HSP22 purification Ammonium sulfate was added to the supernatant up to a final concentration of 0.3 m and the sample obtained was loaded ... both at neutral [32] and alkaline pH [33], the wild-type HSP22 and its mutants migrated as a single band with an apparent molecular mass of approximately 60 kDa (data not shown), thus indicating ... intensities of the band of intact protein at the beginning of trypsinolysis and at the fixed time of trypsinolysis) against the time of incubation (Fig 8D) The apparent rate constants of trypsinolysis...
  • 15
  • 431
  • 0
Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc

Tài liệu Báo cáo khoa học: Regulation of the members of the mammalian heat shock factor family doc

Ngày tải lên : 18/02/2014, 04:20
... intra- and intermolecular interactions and various post-translational modifications [32,33] In the inactive state, HSF1 prevails as a monomer, and it is thought that the C-terminal heptad repeat ... (CHIP), a co-chaperone of Hsp70, has been shown to interact with HSF1 and to activate HSF1mediated transcription [75] Another mediator of HSF1 activation is the nuclear protein FAS death domainassociated ... DNA-binding and transcriptional activities must be attenuated (Fig 1B) The attenuation mechanism cannot be explained solely by the negative-feedback loop, because an increase in the concentration of Hsps...
  • 14
  • 549
  • 0
Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt

Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt

Ngày tải lên : 19/02/2014, 06:20
... represent a problem that the cell has to challenge to promote the formation and clearance of these bodies Aggregate clearance could therefore be balanced between the rate of huntingtin aggregation and ... example, aggregated htt-polyQ in neuronal inclusions of HD mice and HD patients appears to be ubiquitylated [20] The accumulation of ubiquitylated abnormal proteins results in the formation of pathologic ... greater than · 101 was recorded during the FACS analysis The percentage of decrease of DYm was calculated as the ratio of the percentage of cells with FL2-H fluorescence greater than · 101 in the...
  • 18
  • 721
  • 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Ngày tải lên : 22/02/2014, 04:20
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 ... organic solvents, a- irradiation, temperature extremes and desiccation, the latter probably a cue that terminates diapause [53] As one remarkable example of stress resistance, fully hydrated cysts survive...
  • 10
  • 495
  • 0
Báo cáo khóa học: Some properties of human small heat shock protein Hsp20 (HspB6) potx

Báo cáo khóa học: Some properties of human small heat shock protein Hsp20 (HspB6) potx

Ngày tải lên : 07/03/2014, 15:20
... or greater than that of commercial a- crystallin At pH 7.0, the heating of isolated ADH in the absence of divalent cations was accompanied by aggregation and a large increase in the light scattering ... an increase of the lag period and a decrease in the amplitude of light scattering Significant retardation of the insulin B-chain aggregation was observed at an insulin/Hsp20 ratio of : At a mass ... conditions, among them acidosis For instance, the data of Wang [38] indicate that a- crystallin prevents acidification-induced aggregation of creatine kinase and luciferase In our study, at pH 6.0, a- crystallin...
  • 12
  • 372
  • 0
Báo cáo khoa học: Small heat shock protein Hsp27 prevents heat-induced aggregation of F-actin by forming soluble complexes with denatured actin docx

Báo cáo khoa học: Small heat shock protein Hsp27 prevents heat-induced aggregation of F-actin by forming soluble complexes with denatured actin docx

Ngày tải lên : 16/03/2014, 06:20
... temperature fluctuations were approximately ± 0.1 °C DLS data were accumulated and analyzed with the multifunctional real-time correlator Photocor-FC dynals software (Alango, Tirat Carmel, Israel) ... for native actin filaments or actin aggregates formed upon thermal denaturation of F-actin in the absence of Hsp27-3D Analytical ultracentrifugation of the Hsp27-3D complexes with denatured actin ... on the heatinduced aggregation of F-actin (A) F-actin (1.0 mgÆmL)1) was heated at a constant rate of C°Æmin)1 in the absence (curve 1) or in the presence (curves 2–4) of Hsp27-3D, and aggregation...
  • 12
  • 319
  • 0
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx

Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx

Ngày tải lên : 30/03/2014, 20:20
... Mutation Primer sequence N-terminal extension G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ ... Research Council of Canada Discovery Grant, a Nova Scotia Health Research Foundation ⁄ Canadian Institutes of Health Regional Partnership Plan Grant, and a Heart and Stroke Foundation of Nova Scotia ... modification the sHSPs contribute to cataract and desmin-related myopathy, among other diseases [37–40] The extremophile crustacean, Artemia franciscana, populates aquatic environments of high salinity,...
  • 14
  • 358
  • 0
Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot

Báo cáo Y học: A critical motif for oligomerization and chaperone activity of bacterial a-heat shock proteins pot

Ngày tải lên : 31/03/2014, 21:21
... mammalian a- crystallins, the oligomerization principles of bacterial a- Hsp proteins have received little attention Available data indicate that a- Hsp proteins from prokaryotes and plants may differ ... indicate amino acids that are identical in at least 80 or 60% of all proteins, respectively Arrows mark truncations introduced to HspH and HspF, and asterisks indicate alanine exchange mutations ... study the principles of a- Hsp assembly and the relation between complex formation and chaperone activity, we constructed a series of truncated and point-mutated a- Hsp variants A total of 19 a- Hsp...
  • 9
  • 467
  • 0
báo cáo khoa học: "Heat-shock proteins in infection-mediated inflammation-induced tumorigenesis" potx

báo cáo khoa học: "Heat-shock proteins in infection-mediated inflammation-induced tumorigenesis" potx

Ngày tải lên : 10/08/2014, 22:20
... in the urinary bladder of schistosomal patients may enhance the carcinogenic potential of these agents by increasing their rate of activation Furthermore, in patients with S haematobium and bladder ... may also participate in the activation of procarcinogens, such as aromatic amines and polycyclic aromatic hydrocarbons, generating carcinogenic metabolites [102] An increased number of inflammatory ... approved the 21 Coussens LM, Werb Z: Inflammation and cancer Nature 2002, 420:860-867 Mantovani A, Allavena P, Sica A, Balkwill F: Cancer-related inflammation Nature 2008, 454:436-444 Srivastava P:...
  • 10
  • 587
  • 1
Local induction of heat shock proteins using magnetic fluid hyperthermia for ocular neuroprotection in glaucoma

Local induction of heat shock proteins using magnetic fluid hyperthermia for ocular neuroprotection in glaucoma

Ngày tải lên : 09/09/2015, 10:08
... Yamada, Minhong Jeun, Seongtae Bae and Yasushi Takemura, “Magnetic Characterization and Self-Heating of Various Magnetic Nanoparticles for Medical Applications” The 3rd IEEE International NanoElectronics ... coating and dispersion statuses, magnetic nature of the particles, and temperature [70] In addition, the particles can be aggregated due to gravitational energy (Eg) The gravitational energy of ... Hiroki Kobayashi, Atsuo Hirukawa, Asahi Tomitaka, Tsutomu Yamada, Minhong Jeun, Seongtae Bae and Yasushi Takemura, “Self-Heating Properties under AC Magnetic Field and Their Evaluation by AC/DC Hysteresis...
  • 191
  • 205
  • 0
Immunomodulatory roles of heat shock proteins

Immunomodulatory roles of heat shock proteins

Ngày tải lên : 09/10/2015, 11:06
... into the wells at appropriate final concentrations GM-CSF was added to a final concentration of 20 ng/mL The cells were incubated for 16 h at 37 °C The supernatants were harvested and assayed ... triplicates (some data were obtained in duplicates) IL-2 accumulation in the supernatant was measured 24 h after adding B3Z cells as an indicator of T cell activation The results are expressed as ... triplicates (some data were obtained in duplicates) IL-2 accumulation in the supernatant was measured 24 h after adding B3Z cells as an indicator of T cell activation The results are expressed as...
  • 152
  • 547
  • 0

Xem thêm