... (1.2) Assume that the average growth rates in (1.2) change at equally spaced time intervals and estimates of the population size are made at equally spaced time intervals, then we can incorporate ... Ginzburg, and H R Akcakaya, Variation in plankton densities among lakes: a case for ratio-dependent predation models, The American Naturalist 138 (1991), 1287–1296 [2] J Chattopadhyay, Effect of toxic ... Nonlinear Analysis: Real World Applications (2004), no 1, 45–53 [4] M Fan and K Wang, Periodic solutions ofadiscretetime nonautonomous ratio-dependent predator-prey system, Mathematical and Computer...
... (1978) "Language generation: Automatic Control of Grammatical Detail", COLING78 Bergen Norway ['7] Fay, D (1977) "Transformational International Congress of Linguistics Austria Errors" Vienna, [8] ... Vienna, [8] McDonald D.D (in preparation) Natural Language Production as a Process of Decision-making U n d e r ConsU'alnt Ph.D Dissertation, Department of Electrical Engineering and Computer Science, ... or intonation and can make no specific contribution= to the explanation of errors at that level s e l f - c o r r e c t i o n data and c e r t a i n l i n g u i s t i c constra_nts Regretably,...
... same-voice, same-place and same-manner which check if curr is exactly identical to out or shares the exact value ofa particular feature Our choiceof templates and features is based on standard ... dewaanah:94, waanih:37, wahnah:16, waan:13, wahneh:8, wahnih:5, wahney:3, waanlih:3, rived from the same intended form, assuming gold wehnih:2, waaneh:2, waonih:2, waaah:1, standard word boundaries ... statistical learning mechanism In Proceedings of the Student Research Workshop at EACL Armen Allahverdyan and Aram Galstyan 2011 Comparative analysis of Viterbi training and ML estimation for...
... bigram language model Then each of these analysis is rescored using the TAG channel modelanda syntactic parser based language model The TAG channel model s analysis not reflect the syntactic ... necessary that the intersection (in language terms) of the TAG channel modeland the language model itself be describable by a TAG One way to guarantee this is to use a finite state language model; ... initial analysis, replacing the bigram language model with a syntactic parser based model We not need to intersect this parser based language model with our TAG channel model since we evaluate each...
... kanji katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hiragana-kanji percent 45.1% 11.4% ... < a l p h a > , < h i r a > , < k a t a > , and < k a n > represent a sequence of symbols, numbers, alphabets, hiraganas, katakanas, and kanjis, respectively < k a n - h i r a > and < h i r a ... speech Table shows examples of common charto Chinese characters Hiragana and katakana are acter bigrams for each part of speech in the infresyllabaries: The former is used primarily for grammatical...
... Bentivogli and Pianta, 2005) The phenomenon of formal and informal address has been considered in the contexts of translation into (Hobbs and Kameyama, 1990; Kanayama, 2003) and generation in Japanese ... Table 1: Manual annotation for T/V on a 200-sentence sample Comparison among human annotators (A1 and A2 ) and to projected gold standard (GS) All cells show raw agreement and Cohen’s κ (in parentheses) ... Hiroshi Kanayama 2003 Paraphrasing rules for automatic evaluation of translation into Japanese In Proceedings of the Second International Workshop on Paraphrasing, pages 88–93, Sapporo, Japan Philipp...
... ⁄ G93ASOD1 S Tartari et al A (1) tTA-40 (3) HighG9 3A- tTA (2) HighWT-tTA (4) LowG9 3A- tTA B C Fig GR and GST activity in the conditional FALS1 model (A) GR and (B) GST activity were evaluated in ... lower than in highWT-tTA cells under basal conditions and after t-BHQ treatment (Fig 8A) , indicating that highG9 3A- tTA cells had a lower antioxidant capacity than those expressing a comparable level ... system (Amersham Biosciences, Little Chalfont, UK) Films were scanned and band intensities obtained with an AIS Image Analyser (Imaging Research Inc., St Catharine’s, Canada) Enzymatic activities...
... useschronic and acute asthma ([neoplastic] Ê (lung Q cancer)) ([therapeutic] Ê (radiation Q therapy)) lung cancer lung cancer, radiation therapy ([disease]Êpancytopenia) ([neoplastic]Ê(acuteQmegakaryocyticQleukemia)) ... female with anorexia/bulimia complications and management of anorexia and bulimia ([disease] Ê diabete) ([disease] Ê (peripheral Q neuropathy)) ([therapeutic] Ê pentoxifylline) 50 year old diabetic ... Salminen and Frank Tompa 1994 Pat expressions: an algebra for text search Acta Linguistica Hungarica, 41(1-4):277306 Anja Theobald and Gerhard Weilkum 2000 Adding relevance to XML In Proceedings of...
... Combinatory Categorial Grammar (CCG) framework, and assume only that the learner has access to a small set of general combinatory schemata anda functional mapping from semantic type to syntactic ... → A to generate A as the top syntactic node ofa parse tree andA → [A] lex to indicate that A is a leaf node in the syntactic derivation and should be used to generate a logical expression and ... (1992) Sakas and Fodor (2001), and Yang (2002) These all evaluate their learners on the basis ofa small number of predefined syntactic parameters Finally, our work addresses a misunderstanding about...
... this article This research was supported by the National Natural Science Foundation of China (No 11031002) Authors’ contributions JL carried out the theoretical analysis and simulation, and drafted ... and drafted the manuscript JW conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing ... bifurcation occurring are also searched And the stability and direction of the bifurcating periodic solutions at l1 are studied In Section 3, some conclusions are stated Hopf bifurcation analysis...
... So far, only two papers have dealt with the topic of discrete- time modelling of an analogue audio oscillator module De Sanctis and Sarti derived a wave-digital filter model for an astable multivibrator ... represent a variety of currently available approaches, and they are briefly reviewed next 3.1.1 Ideally Bandlimited Sawtooth Oscillator As the first approach, an ideally bandlimited oscillator algorithm ... algorithms As can be seen in Figures 13 (a) , the polynomial approximation of the filter parameters (solid line) has an RMSE that is at its maximum as bad as that of the tabulated parameter estimates...
... cancellation or to accomplish a feedback summation for the ΣΔ loop operation Since the charge of four capacitors is added, there is a charge gain of M = anda voltage gain of Again, as explained ... to be in a low capacitance value, the parasitic capacitance of the MIM capacitors and transistors still has an effective Q of about 100 Compared to MOS capacitor, MIM capacitor provides a much better ... this gain depends on the absolute physical parameters of usually low tolerance (gm value of the preceding LNTA stage and the total integrating capacitance of the sampling mixer), it is advantageous...
... 5'-GCCTCCAGCATGAAAGTCTC, 3'-TAAAACAGGGTGTCTGGGGA), IL-1β (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 ... (5'-GTCCTCTCCCAAGTCCACACA, 3'-CTGGTCTCAAGTCAGTGTACAGGTAA), CC chemokine ligand (CCL)5 (formerly called RANTES; 5'-CGCTGTCATCCTCATTGCTA, 3'-GCTGTCTCGAACTCCTGACC), CCL2 (formerly called MCP-1; 5'-GCCTCCAGCATGAAAGTCTC, ... fibroblast-like synoviocytes (FLS), and vascular endothelial cells, and probably play a pivotal role in the pathogenesis of RA [4-7] The cytokines IL-1 and TNF-α activate and can be activated by...
... innocuous and/ or harmless commands (2), actual appeasement i.e preparatory acts or gestures (3), partial compliance with at least one severe command (4), full compliance with at least one severe command ... care of the clinical team (ii) age ≥16, (iii) history of command hallucinations of at least months with history of harm to self, others or major social transgressions as a result of the commands; ... primary diagnosis and insufficient command of the English language Recruitment and randomisation Eligible participants are identified by Clinical Studies Officers from the UK Mental Health Research...
... primers and probe were: NS1-FP (forward primer): 5’-GAAGACTGGATGATGACAGATCCA-3’, NS1-RP (reverse primer): 5’-TGCTGTTTTTGTTCT TGCTAGAGTAA-3’ NS1-P (probe): FAM-AATGATGGCTCAAACCGGAGGAGA-BHQ1 The ... was labeled with 6carboxyfluorescein (FAM) at the 5’-end and with BHQ1 at the 3’-end Preparation of standard plasmid DNA PCR amplification of the NS1 gene was carried out in a reaction mix of ... Rotor-Gene software Sensitivity of the real -time PCR To determine the detection limit and efficiency of the assay, recombinant plasmid of standard DNA was used as a template and was 10-fold serially diluted...
... Sequences 5' GAGTGGGCTCACTTCCGATG 3' 5' GCTGAACACCTCACTGCTTGG 3' 5' CAACAACGACGAGAAGTTCTACTTATCCAAAG G 3' 5' CCAGCACCATCTCTACAACCC 3' 5' GCAAAGCTCCTGTTTGCACTC 3' 5' CCCAAACTATCTCAACCTCAGGGTCCACC 3' ... administration of × 109 pfu of AdCMV-VP16-PPAR-γ2 at the timeof intranasal administration of CRA and again d later, at the timeof IT CRA challenge Control mice received empty adenoviral vector at the same ... localized to the airway by intranasal instillation of CRA 14 days later After another days (day 19 from initial sensitization), mice were anesthetized with an intraperitoneal ketamine and xylazine mixture...
... developed a multiscale mathematical modelof these processes to study the efficacy of radiotherapy Several mathematical frameworks have been developed to model avascular and vascular tumor growth ... because of hypoxia, through SMAD gene activation Finally, according to the model parameters, APC and SMAD/RAS Page of 19 (page number not for citation purposes) Theoretical Biology and Medical Modelling ... such that if ndsb due to the irradiation dose is above Thr at any time, p53 is activated and the cells are labeled as 'DNA damaged cells' DNA damaged cells are identified at the R point of the...
... 100:4678-4683 Morimoto T, Kadoya R, Endo K, Tohata M, Sawada K, Liu S, Ozawa T, Kodama T, Kakeshita H, Kageyama Y, Manabe K, Kanaya S, Ara K, Ozaki K, Ogasawara N: Enhanced recombinant protein productivity ... the Additional data files, including metabolite structures (Additional data file 3), metabolite data (Table S1 in Additional data files and 2), reaction data (Table S2 in Additional data files and ... optimized model All of the variables and constants used in Equations 29 and 30 have the same meaning as in Equations 14 and 15 Although the objective, remaining constraints, and remaining variables...
... this time line, or at the beginning of each period I Present Value of an End -of- the -Period Annuity The present value of an annuity can be calculated by taking each cash flow and discounting it back ... Present Value of Annuities Assume again that you are the owner of Infosoft, and that you have achoiceof buying a copier for $10,000 cash down or paying $ 3,000 a year for years for the same copier ... higher than the future value of an equivalent annuity at the end of each period Illustration : IRA - Saving At The Beginning Of Each Period Instead Of The End Consider again the example of an individual...
... issues of loss and bereavement at a very early age Additionally, being raised by grandmothers places orphans at an added disadvantage, as the quality of care they get is compromised Grandmothers are ... in Palapye The mandate of the Land Board is to administer land applications and allocations The District Council, which is composed of the local political leadership and local civil servants, ... www.hsrcpress.ac.za The situation of orphans in sub-Saharan Africa The AIDS epidemic has created an estimated 15 million orphans worldwide Eighty per cent of these orphans live in Sub-Saharan Africa (Kanabus...