a move toward performance based budgeting

A study of simulation performance based on event orderings

A study of simulation performance based on event orderings

... simulated Critical path analysis simulates event execution based on causal relationship and builds critical path to analyze the simulation performance Wong et al proposes a critical path-like analyzer ... overall research methodology in this chapter An analytical method was used to analyze the inherent event parallelism of a problem TSA was used to analyze the performance of parallel simulation based ... simulator using the SPaDES/Java simulation library and studied its performance The implementation and validation tools used include CSIM, SPaDES/Java, and TSA TSA is validated in detail using a...

Ngày tải lên: 26/09/2015, 10:13

121 286 0
Testing a model of customer-based brand equity in the Vietnamese banking servic

Testing a model of customer-based brand equity in the Vietnamese banking servic

... Original Model of Customer Based Brand Equity Rational associations Brand evaluations Product quality Service quality Rational Evaluation Price Customer-Brand Relationship Promise Emotional Evaluation ... perceived quality and objective quality and can be expressed by an equation of performance and expectations, service quality = [performance – expectations] (Cronin and Taylor, 1992; Parasuraman et al, ... is taken into account reinforces the idea that brand equity is a relational market -based asset” (Elena and José, 2005) Martensen and Grønholdt (2004) argue “that being a credible company has a...

Ngày tải lên: 06/11/2012, 15:52

81 563 1
Tài liệu Guide to a Balanced Scorecard Performance Management Methodology doc

Tài liệu Guide to a Balanced Scorecard Performance Management Methodology doc

... provides a performance management strategy that any federal agency can follow, regardless of the functional area, and enables an agency to tailor an assessment approach that supports accomplishment ... which actual achievement can be compared Performance measure A quantitative or qualitative characterization of performance Performance measurement A process of assessing progress toward achieving ... conceptual framework for performance measurement and management What is Performance Management? There are a wide range of definitions for performance objective, performance goal, performance measure,...

Ngày tải lên: 09/12/2013, 20:15

69 658 1
Tài liệu Bust a Move with Your SSIS – Passing Package Variables docx

Tài liệu Bust a Move with Your SSIS – Passing Package Variables docx

... demonstrates a control flow containing a looping task, several SQL tasks, and a dataflow using a merge object Declaring package variables and passing variable values between tasks requires careful attention ... is case-sensitive and must match a package variable name, with the @ prefix necessary in this property page For example, the variable @MaxRows matches the MaxRows package variable An appropriate ... into various tasks objects that make up the package One of the challenges to application development in a database is to have data available for testing and reporting Adding to this challenge are...

Ngày tải lên: 17/01/2014, 06:20

15 362 1
A study on culture based activities in developing cross cultural awareness for the first year students at hanoi national economics university

A study on culture based activities in developing cross cultural awareness for the first year students at hanoi national economics university

... teaching, a laissez-faire approach is not adequate Just as we are intentional in terms of what grammatical structures we teach and how, we must also be systematic about our culture teaching A ... English language learning As a matter of fact, the learning of English not only includes language (grammar and vocabulary) and language skills (listening, speaking, writing and reading) but also ... culture” of the language classroom a neutral space that learners can create and use to explore and reflect on their own and the target culture and language Some teachers and researchers have found it...

Ngày tải lên: 29/01/2014, 10:33

40 897 3
Tài liệu Performance-Based Management Systems Effective Implementation and Maintenance docx

Tài liệu Performance-Based Management Systems Effective Implementation and Maintenance docx

... explained later, there are ways to overcome the limitations of performance measurement so that managers can have confidence in their performance- based management system Performance- Based Management among ... Comparative and Development Public Administration: Second Edition, edited by Ali Farazmand 95 Financial Planning and Management in Public Organizations, Alan Walter Steiss and Emeka O Cyprian Nwagwu ... data on performance Thus, performance measurement information can be readily available to fulfill a manager’s day-to-day information requirements Others have also argued that performance measurement...

Ngày tải lên: 15/02/2014, 20:20

302 1.2K 0
Social Audit: A Toolkit A Guide for Performance Improvement and Outcome Measurement doc

Social Audit: A Toolkit A Guide for Performance Improvement and Outcome Measurement doc

... perfoDirected towards recording, rmance against standards, processing, summarising examining and analysing and reporting of financial deviations, taking corrective data actions and reappraising standards ... personal interviews and obtaining information through questionnaires Social Auditor(s) must go around and meet local administration and Gram Panchayat members, particularly Panchayat Secretary and ... Information Movement: MKSS Mazdoor Kisaan Shakti Sangathan (MKSS) is an organisation of rural people that has become well known in India for its use of public hearings as an aid to accountability Based...

Ngày tải lên: 06/03/2014, 23:20

101 443 1
LabelMe: a database and web-based tool for image annotation pdf

LabelMe: a database and web-based tool for image annotation pdf

... gnawer, gnawing animal; placental, placental mammal, eutherian, eutherian mammal; mammal, mammalian; vertebrate, craniate; chordate; animal, animate being, beast, brute, creature, fauna; organism, ... attributes such as pose By analogy with the speech and language communities, history has shown that performance increases dramatically when more labeled training data is made available One can ... evaluation To achieve this, we developed a web -based tool that allows easy image annotation and instant sharing of such annotations Using this annotation tool, we have collected a large dataset...

Ngày tải lên: 07/03/2014, 23:20

33 515 1
Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx

Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx

... informative to compare our results with those reported in (Blaheta and Charniak, 2000) for this same task Blaheta and Charniak measured tagging accuracy and precision/recall for functional tag identification ... for evaluation on bare labels suggests that our approach is capable not only of adding functional tags, but can also correct the parser’s phrase labels and partof-speech tags: for Collins’ parser ... parser itself, but is available in a treebank Using the method with two state of the art statistical parsers and the Penn Treebank allowed us to recover functional tags (grammatical and semantic),...

Ngày tải lên: 08/03/2014, 04:22

8 379 0
Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx

Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx

... accuracy as the beam is narrowed DARPA Speech and Natural Language Workshop T Briscoe and J Carroll 1993 Generalized LR Parsing of Natural Language (Corpora) with Unification -Based Grammars Computational ... contains Ideally we would like to integrate POS tagging into the parsing model rather than treating it as a separate stage This is an area for future research The Parsing Algorithm The parsing algorithm ... Ramshaw and M Marcus 1995 Text Chunking using Transformation -Based Learning Pro- I would like to thank Mitch Marcus, Jason Eisner, Dan Melamed and Adwait Ratnaparkhi for many useful discussions, and...

Ngày tải lên: 08/03/2014, 07:20

8 320 0
COSTING GREEN: A COMPREHENSIVE COST DATABASE AND BUDGETING METHODOLOGY pot

COSTING GREEN: A COMPREHENSIVE COST DATABASE AND BUDGETING METHODOLOGY pot

... information can be applied to all costs as they are extracted Once the data is extracted, further statistical or graphical analysis can easily be performed In addition to cost data, the knowledgebase ... boundaries and create highly efficient, sustainable buildings to serve as examples, and push market transformation LEED provides a means to actually measure sustainability using accepted standards ... Comprehensive Cost Database and Budgeting Methodology point can be awarded if an owner provided a fleet of alternatively fueled vehicles, our database contains only a handful that have taken this route...

Ngày tải lên: 16/03/2014, 16:20

27 309 0
Báo cáo khoa học: "A Tree Sequence Alignment-based Tree-to-Tree Translation Model" potx

Báo cáo khoa học: "A Tree Sequence Alignment-based Tree-to-Tree Translation Model" potx

... translation HLT-NAACL-03 127133 Philipp Koehn 2004 Pharaoh: a beam search decoder for phrase -based statistical machine translation models AMTA-04, 115-124 Philipp Koehn, Hieu Hoang, Alexandra Birch, ... 961-968 Daniel Gildea 2003 Loosely Tree -Based Alignment for Machine Translation ACL-03 80-87 Jonathan Graehl and Kevin Knight 2004 Training tree transducers HLT-NAACL-2004 105-112 Mary Hearne and Andy ... span iteratively from small one to large one (lines 1-2) This strategy can guarantee that when translating the current span, all spans smaller than the current one have already been translated...

Ngày tải lên: 17/03/2014, 02:20

9 303 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers ... 667–674 239 CAGCTgtaag/tccagGTCTG A B C D 163 243 671 261 CAGCTgtaag/tccagGTCTG GGGCGgtgag/tccagTTGAA AGGCGgtgag/caaagCTGAA GACCGgtaag/tccagCTGCT CTGTGgtgag/tgcagGAGGC (110) GACCGgtaag/tccagCTGCT...

Ngày tải lên: 17/03/2014, 03:20

10 451 0
Báo cáo khoa học: " A Decoder for Syntax-based Statistical MT" doc

Báo cáo khoa học: " A Decoder for Syntax-based Statistical MT" doc

... grammars and bilingual parsing of parallel corpora Computational Linguistics, 23(3) K Yamada and K Knight 2001 A syntax -based statistical translation model In ACL-01 References H Alshawi, S Bangalore, ... We have presented a decoding algorithm for a syntax -based statistical machine translation The translation model was extended to incorporate phrasal translations Because the input of the channel ... The mathematics of statistical machine translation: Parameter estimation Computational Linguistics, 19(2) E Charniak 2001 Immediate-head parsing for language models In ACL-01 M Collins 1999 Head-Driven...

Ngày tải lên: 17/03/2014, 08:20

8 226 0
Báo cáo khoa học: "Lexicon acquisition with a large-coverage unification-based grammar" pot

Báo cáo khoa học: "Lexicon acquisition with a large-coverage unification-based grammar" pot

... the status of the features Barg and Walther (1998) talk about generalisable and revisable information The former are values that are too specific (e.g case), while the latter are values that should ... — and can therefore be realised by a type — the fact that it is a plural will restrict it further Evaluation There are two aspects that are relevant to be measured: the quality of the newly acquired ... with a grammar of a similar coverage We have described a way how the information concerning unknown words can be restricted in a grammatically sound way, by the definition of lexical types and...

Ngày tải lên: 17/03/2014, 22:20

4 251 0
Báo cáo khoa học: Prediction of coenzyme specificity in dehydrogenases ⁄ reductases A hidden Markov model-based method and its application on complete genomes doc

Báo cáo khoa học: Prediction of coenzyme specificity in dehydrogenases ⁄ reductases A hidden Markov model-based method and its application on complete genomes doc

... preference among archaean, bacterial, and eukaryotic genomes Kingdom FAD NAD NADP Archaea Bacteria Eukaryota 0.21 0.21 0.21 0.49 0.46 0.41 0.30 0.33 0.38 Among the annotated human Rossmann proteins, ... classified as false, i.e nonRossmann fold Among the NAD-binding proteins a total of 10 are false negatives: four are lost during the database search, five are classified as false, and one is classified as ... 18 and 15%, respectively The bacterial genome of Chlamydophila caviae also show a dual sites proportion of 15%, while the archeal genomes of Thermococcus kodakaraensis and Nanoarchaeum equitans...

Ngày tải lên: 23/03/2014, 10:21

8 481 0
Báo cáo khoa học: "A Syntactic and Lexical-Based Discourse Segmenter" pdf

Báo cáo khoa học: "A Syntactic and Lexical-Based Discourse Segmenter" pdf

... all three annotators using Kappa was 85, showing a high level of agreement Using F-score, average agreement of the two annotators against the gold standard was also high at 86 The few disagreements ... the Stanford parser as an alternative to the Charniak parser show that the performance of our system is parser-independent High F-score in the Treebank data can be attributed to the parsers having ... taken from RST literature Performance was similar to that of our own annotations, with SLSeg achieving an F-score of 79, and SPADE attaining 38 This demonstrates that our approach to segmentation...

Ngày tải lên: 23/03/2014, 17:20

4 337 0
Báo cáo khoa học: "A Small, Extendible Transformation-Based Learner" docx

Báo cáo khoa học: "A Small, Extendible Transformation-Based Learner" docx

... memory, and is in certain respects more general Small is beautiful, however, and the light version may also have a greater pedagogical value Both versions can be downloaded from crue The call to ... Leader, HiScore, Winner) ) Winner = Leader Based Learning, In: Proceedings of CoNLL-99, Bergen Brill, Eric 1995 Transformation -Based ErrorDriven Learning and Natural Language Processing: A Case ... learner In each case, the accuracy of the resulting sequence of rules was measured on a test corpus consisting of 40k words, with an initial-state accuracy of 93.3~ T h e following table summarizes...

Ngày tải lên: 24/03/2014, 03:20

2 231 0
FINANCIAL STATEMENT ANALYSIS: A TOOL FOR PERFORMANCE EVALUATION

FINANCIAL STATEMENT ANALYSIS: A TOOL FOR PERFORMANCE EVALUATION

... 2Financial Statement Analysis: A Tool for Performance Evaluation Jan 2010 3Financial Statement Analysis: A Tool for Performance Evaluation ABSTRACT Financial statements are prepared to meet ... financial data, comparing financial data across companies, and analyzing key financial ratios Financial statement analysis is defined as the process of identifying financial strengths and weaknesses ... HORIZONTAL ANALYSIS OR TREND ANALYSIS 9Financial Statement Analysis: A Tool for Performance Evaluation Comparison of two or more year's financial data is known as horizontal analysis, or trend analysis...

Ngày tải lên: 25/03/2014, 12:15

25 570 0
w