... the forward primer 5¢-GG AATTCCATATGCAACCCACTCATACGCTAACAAG-3¢ (with the NdeI restriction recognition sequence underlined) and the reverse primer 5¢-CGGGATCCTTATTTTAATT TTACCTGATTGAAGGTTGAG-3¢ ... oligonucleotide pair 2: 5¢-GCTACGTTTAAAGCGATGATGAACCTGGAAATG CTCGAGTCC-3¢ (forward primer with DraI site underlined) and the same reverse primer Oligonucleotide pair for amplification of MT0975 (217 amino acid ... generated by a crystallographic two-fold The data and refinement statistics are shown in Table The Ramachandran plot has 96.9% of the residues in the most favored region and 3.1% in the additional...
... CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGTGGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATTGCTATGATTAGTGCTA CTATCAATGCTCCTACTCCTAATTTATAATCTAAATTTAACATCTC The ... GGATCCATGCAACCTATAATAGTA GCAATA and VpuNL-R, GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu-R5-F, GGATCCATGTTAAATTTAGATTATAAATTAGGAGTA GG and Vpu-R5-R, GAATTCATTACAAATCATTAACATCCAAAAGCC The amplified fragments ... AGTAGTAGCAATAATAATAGCAATAGCTGTGTGGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; for the R5 vpu TM region, R5TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG...
... outcomes assessed Page 12 of 14 analysed, and interpreted data; drafted the manuscript; and provided administrative, technical or material support JP acquired data; drafted the manuscript; and provided ... provided administrative, technical, or material support LWK and TN acquired data and drafted the manuscript NLW acquired, analysed, and interpreted data; drafted the manuscript; provided administrative, ... the manuscript; and provided statistical analysis RJS analysed and interpreted data; and drafted and critically revised the manuscript JAM acquired, References Fiks AG, Hunter KF, Localio AR,...
... JCP acquired, analyzed, and interpreted data; drafted the manuscript; provided statistical analysis; and provided administrative, technical, or material support LWK and TN acquired data and drafted ... manuscript; obtaining funding; study supervision He is the guarantor NS acquired, analyzed, and interpreted the data; and drafted the manuscript RL analyzed and interpreted data; and critically ... employing a comprehensive search strategy of MEDLINE, EMBASE, Evidence-Based Medicine Reviews databases (Cochrane Database of Systematic Reviews, DARE, ACP Journal Club, and others), and the Inspec...
... year) when evaluating employees’ performance and granting awards; and (4) reducing the sensitivity of awards to measures of short-term performance.6 Each method has advantages and disadvantages ... U.S Bancorp; and Wells Fargo & Company; and the U.S operations of Barclays plc, BNP Paribas, Credit Suisse Group AG, Deutsche Bank AG, HSBC Holdings plc, Royal Bank of Canada, The Royal Bank of ... Firms often determine the dollar amount of incentive compensation awards for a performance year immediately after the end of the year Part of the award may be paid immediately and part may be...
... significantly increased chance of reaction to the lysed microfilariae This Mazzotti reaction comprises itching, rash, fever, tachycardia and hypotension, and is sometimes fatal A small trial of 40 patients ... usually due to respiratory syncytial virus, is a leading cause of respiratory failure in infants A systematic reviewof randomised, controlled trials in mechanically ventilated infants totalling ... resolution of organ failure and reduction in hospital stay [26] The population setting may be of importance A large randomised trial of paediatric meningitis in a developing country with late presentation...
... middle and late substrate colonization stages (4, and 12 days); pinhead stage (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22) and mature stage (day 23) After collection, ... extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank Accession No AY249052) ... CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella volvacea (Eur J Biochem 271) 323 Fig Alignment of deduced amino acid sequences of lac1 and other fungal laccases...
... A Vignal et al Genomic DNA from genetically distant individuals Excise, clone in plasmid Mixing, restriction digestion Sequence library ACGTGAATTCACTAG ACGTGAATTCACTAG ACGTGAACTCACTAG ACGTGAATTCACTAG ... ACGTGAATTCACTAG ACGTGAACTCACTAG ACGTGAATTCACTAG Align sequence traces and search for mismatches Agarose gel electrophoresis Figure Reduced representation shotgun (RRS), for SNP discovery As a test ... especially in random approaches such as RRS and the comparison of EST sequences This can be partially overcome for species in which databases of repeated elements are available, that can be used...
... 19 Aarhus M, Helland CA, Lund-Johansen M, et al Microarray-based gene expression profiling and DNA copy number variation analysis of temporal fossa arachnoid cysts Cerebrospinal Fluid Research ... history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are not relatively rare by themselves However, we have only ... Ramsey NF, Mandl RC, et al Language lateralization in monozygotic twin pairs concordant and discordant for handedness Brain 2002; 125: 2710-8 Vernooij MW, Ikram MA, Tanghe HL, et al Incidental...
... 40-50% of trabecular mass by 90 years of age [58] This results in a decline in the loadbearing capacity of the vertebral body For example, load bearing capacity in a lumbar vertebra can decrease from ... end plate The disc facilitates intersegmental movement while maintaining alignment of the vertebral column and has a primary role in attenuating and dispersing axial load With aging, the water ... osteoporosis and are associated with back pain, functional disability, reduced health-related quality of life and increased mortality These associations become more significant with increasing numbers of...
... situations, availability of alternative transport and changing health are major reasons for driving reduction and cessation (e.g., Raitanen et al., 2003; Charlton et al., 2006; Ragland et al., ... rates based on US Fatality Analysis Reporting System (FARS) data for 1997, National Highway Transport Safety Administration (NHTSA) (see Table 1.) Table 1: Number of driver fatalities and fatality ... especially for older drivers Casualty crash analyses, even those encompassing casualties of all severity, have a sampling bias: the so-called ‘frailty bias’, which exaggerates any apparent age-related...
... Predicting bank performance with financial forecasts: A case of Taiwan commercial banks Journal of Banking and Finance, 28, 2353—2368 Karels, G V — Prakash, A J (1987) Multivariate normality and forecasting ... stochastic DEA Kao and Liu (2004) formulate a DEA model of interval data for use in evaluating the performance of banks Their study makes advance predictions of the performance of 24 Taiwan banks ... combination of linear programming (LP) and DA Using data from the National Bank of Belgium, they find that MSD, DEA and C5.0 obtain the correct classification rates of failure for 78.9%, 86.4% and 85.5% of...
... paraguayensk (matC) (Aquifoliaceae), Coffea species (coffee) (Rubiaceae), Paullinia cupana (guarana) (Sapindaceae), Cola acuminata (cola) and Theabroma cacao (cocoa) (Sterculiaceae) and Camellia sinensis ... from Artemisia annua (Asteraceae) is of major importance as an antimalarial because of extensive resistance of Plasmnodiumfalciparum to antimalarials such as chloroquine Artemisinin in has a 3,12-peroxy ... (Lophophora williamsii (peyote) (Cactaceae) paralytic convulsant); (-)-salsolinol (IQ) (Musa paradisiaca (banana) (Musaceae) and Theobroma cacao (cocoa) (Sterculiaceae) dopamine antagonist linked...
... National Oceanic and Atmospheric Administration] OCEAN, COASTAL, AND MARINE EDUCATION CAN: • Enhance public awareness of the ocean and increase scientific literacy • Ensure that present and future ... thematic areas for clarity and appropriateness of thematic research priorities (Task 3a) ; balance among substantive research areas as well as among research activities such as observations, modeling, ... knowledge and understanding of factors contributing to the maintenance and restoration of ecosystem health Enhancing Human Health This theme addresses a broad array of human health issues that relate...
... concentration of radon and its metabolites is increased in concrete single-family homes.129) Nano-particles and Nano-materials The health effects of nano-particles and nano-materials have been reviewed.117–121) ... (in Japanese) IPCS (1989) Environmental Health Criteria 89 Formaldehyde, World Health Organization, Geneva Takeda, M., Saijo, Y., Yuasa, M., Kanazawa, A. , Araki, Aand Kishi, R (2009) Relationship ... Indoor Air Quality Indoor Environ., 1, 27–34 (in Japanese) 126) Kishi, R., Saijo, Y., Kanazawa, A. , Tanaka, M., Yoshimura, T., Chikara, H., Takigawa, T., Morimoto, K., Nakayama, K and Shibata, E (2009)...
... performance benefits of experience, training, and innate ability and also as a summary of the research already completed in this area The report will be of particular interest to policymakers and ... Comments are welcome and may be addressed to Jennifer Kavanagh, RAND Corporation, 1776 Main Street, Santa Monica, California 90407, or Jennifer_Kavanagh@rand.org For more information on RAND's Forces ... Table 2.2 Number of Flights and Marginal Products of Yearof-Service Groups .8 Table 2.3 Mission Capable Rate and Marginal Products of Pay Grade Groups Table 2.4 Mission Capable Rate...
... meals, breakfast cereals, candy, snacks, and beverages, as well as fruits and vegetables and dairy products, and the campaigns generally were integrated across promotional formats The focus of ... meals, frozen waffles, fruit and fruit snacks, breakfast cereals, popcorn, lunch kits, candy, carbonated and non-carbonated drinks, pasta, snack chips, and milk Superman and the Pirates characters ... Disney characters appeared on packages and store displays for fruit snacks, breakfast cereals, candy, yogurt, frozen waffles, toaster pastries, macaroni and cheese, and fruits and vegetables Multi-brand...
... two-exponential model: 5314 X ẳ A1 expkHX;1 ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate ... Authors Journal compilation ê 2006 FEBS R J Sola and K Griebenow Structural dynamics and serine protease catalysis Table Kinetic parameters for the a- CT-, lactose -a- CT-, and dextran -a- CT catalyzed ... protease catalysis Table Global energetic parameters and DebyeWaller temperature factors calculated for the protein portion of a- CT and the various lactose -a- CT conjugate structures modeled and...