a modern method for guitar jazz songbook download

Modern method for guitar 1

Modern method for guitar 1

Ngày tải lên: 16/08/2013, 08:28

127 784 1
Modern method for guitar 2

Modern method for guitar 2

Ngày tải lên: 16/08/2013, 08:28

122 780 2
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared in the buffer supplied with ... enzyme, and contained Aba, Abb and Abcat 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP. The product was separated from...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vessel endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA, paraformaldehyde;...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx

... Annual Meeting of the Association for Computational Linguistics, pages 188-195. Ferreira da Silva, J. and G. Pereira Lopes (1999). A local maxima method and a fair dispersion normalization for ... 605–613, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics A Nonparametric Method for Extraction of Candidate Phrasal Terms Paul Deane Center for Assessment, Design and Scoring ... lexical association measures on unfiltered data no doubt has multiple explanations, but a logical candidate is the failure or inappropriacy of underlying statistical assumptions. For instance,...

Ngày tải lên: 08/03/2014, 04:22

9 507 1
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx

... The load charac- teristics were calculated by varying a load parameter within a preset range of physiologically reasonable values. For each value of the load parameter, the steady state was computed ... increased value of k ATPase as compared to the value k 0 ATPase ¼ 1:6h À1 . At values of k ATPase exceeding seven-fold of its normal value, no stationary states can be found; that is, k max ATPase ¼ ... physiologically feasible ranges: 1 2 k 0 ATPase k ATPase 2k 0 ATPase (small variation of the energetic load) 1 5 k 0 ATPase k ATPase 5k 0 ATPase (large variation of the energetic load) 1 50 k 0 ox ...

Ngày tải lên: 23/03/2014, 06:20

15 456 0
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

... reports, and program reports, such as the Bureau for Africa’s Child Survival in Sub-Saharan Africa – Taking Stock. We assessed the reliability of financial data compiled and generated by USAID’s ... allocations for child survival across sub-Saharan Africa. USAID officials told us that grantees may pilot innovations (see sidebar) or work in a country’s most rural and hard-to-reach areas. Also, ... the CS/MH account, USAID allocated funds for maternal and child health efforts in 40 countries, in Latin America, sub-Saharan Africa, and South Asia. Figure 2 illustrates the global distribution...

Ngày tải lên: 28/03/2014, 09:20

64 380 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot

Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot

... Estimation of Distributional Similarities Jun’ichi Kazama Stijn De Saeger Kow Kuroda Masaki Murata † Kentaro Torisawa Language Infrastructure Group, MASTAR Project National Institute of Information ... of ACL 94. Ido Dagan, Shaul Marcus, and Shaul Markovitch. 1995. Contextual word similarity and estimation from sparse data. Computer, Speech and Language, 9:123–152. Ido Dagan, Lillian Lee, and ... pro- files are multinomial distributions, the pri- ors are Dirichlet, and the base measure is the Bhattacharyya coefficient, we can de- rive an analytical form that allows efficient calculation. For the...

Ngày tải lên: 30/03/2014, 21:20

10 472 0
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot

Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot

... a formula contain informa- tion that is more definite than the information contained in disjunctions. Thus a formula can be regarded as having a definite part, containing only unconditional ... Press, Cam- bridge, England, 1985. [8] Perelra, F. C. N. and D. H. D. Warren. Definite clause grammars for language analysis - a survey of the formal- ism and a comparison with augmented transition ... choosing particular values for the fea- ture). In the analysis of a particular sentence most features have a unique value, and some features are not present at all. When disjunction remains in...

Ngày tải lên: 31/03/2014, 17:20

8 361 0
a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

... respectively. 2.3. Annealing of the materials The anodized titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ Cfor6hinaCVDfur- nace at a heating rate of 1 ◦ C/min. The UAT samples ... the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity de- pending on the material preparation and annealing atmosphere (Fig. 12). Titania nanotubes prepared ... spectra of (a) O 2 annealed UAT, (b) N 2 annealed UAT, (c) as-prepared UAT, and (d) H 2 annealed TiO 2 nanotubes prepared using eth- ylene glycol and ultrasonic treatment. be due to partial incorporation...

Ngày tải lên: 05/05/2014, 15:26

8 634 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

... very faster via using a solvent. The GC chromatograms and area under curve (AUC) data’s are shown in Figures 4 and 5 and Tables 1 and 2. The isopropanol, heptane, toluene and 2-CEPS are diagnosed ... metal atoms. It was reported that polyvinyl pyrrolidone (PVP) could stabilize colloidal particles in water and many non-aqueous solvents by adsorbing onto a broad range of materials, such as ... (PVP) as a capping agent was reported. Then, we have focused our attention on the CaO nanoparticles/ Polyvinyl pyrrolidone (PVP) surface as a solid catalyst due to good catalytic properties and...

Ngày tải lên: 06/05/2014, 08:55

12 705 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx

Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx

... (DCI) DCI was performed after the original analysis. OSNA runs were repeated from discordant sample homoge- nates and afterwards RNA was isolated and subjected toqRT-PCRforCK19,CEA,andbeta-actin.Condi- tions ... Tsujimoto M, Nakabayashi K, Yoshidome K, Kaneko T, Iwase T, Akiyama F, Kato Y, Tsuda H, Ueda S, Sato K, Tamaki Y, Noguchi S, et al: One-step nucleic acid amplification for intraoperative detection ... inves- tigated with both OSNA (CK19 mRNA as a m arker) and intensive histological methods (H&E and CK19 IHC on 5 levels for each of 2 LN slices). RNA quality was assured by OSNA performed for beta-actin....

Ngày tải lên: 18/06/2014, 16:20

6 535 0
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx

Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx

... times a week. The database will be made available free of charge to inter- ested parties. Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon A1 A2 A3 A4 x A4 y Amplification ... Transcriptase (M-MLV RT; Promega) and Enhanced Avian Reverse Transcriptase (AMV-RT; Sigma), an enhanced avian myeloblastosis virus reverse tran- scriptase. Reactions were assembled per manufacturer's instructions ... remote access, it is secured behind a fire-wall, and access is limited to authorized users with valid passwords. The database and all sequence data are backed up to a secure tape- backup system in a...

Ngày tải lên: 19/06/2014, 08:20

9 445 0
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx

Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx

... authors would like to thank Nisse Larson for excellent engineering assistance, Maria Frykman for valuable assistance during data collection and Margaretha Marklund for graphical work. References 1. ... study, participated in the design, statistical analyses of the study and helped to draft the manuscript. All authors read and approved the final manuscript. Additional material Acknowledgements The authors ... self-reported characteristics Self-rated pain was assessed as pain at the moment and measured within a week before the day of testing on a blank 100 mm visual analogue scale (VAS), on which 0...

Ngày tải lên: 19/06/2014, 08:20

10 712 0
báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx

báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx

... an optimum channel/bin, so we used Bhattacharyya distance plots for real movementFigure 2 Bhattacharyya distance plots for real movement. Higher values indicate greater class separability. (a) ... Piccione's system had an average accuracy of 76.2% and a bit rate of 7.59 bits/min with healthy trained subjects [15]. Based on these results, our method appears to have a higher accu- racy at a ... the potential of naturalistic pacing, it still features somewhat unnatural control methods (hand, foot, and tongue motor imagery), as well as variable accuracy and high computational demand. Thus,...

Ngày tải lên: 19/06/2014, 08:20

16 489 0
báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf

báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf

... Transcriptase (M-MLV RT; Promega) and Enhanced Avian Reverse Transcriptase (AMV-RT; Sigma), an enhanced avian myeloblastosis virus reverse tran- scriptase. Reactions were assembled per manufacturer's instructions ... authorized users with valid passwords. The database and all sequence data are backed up to a secure tape- backup system in a different building three times a week. The database will be made available ... made available free of charge to inter- ested parties. Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon A1 A2 A3 A4 x A4 y Amplification efficiency 95 a 98 93...

Ngày tải lên: 20/06/2014, 04:20

9 442 0

Bạn có muốn tìm thêm với từ khóa:

w