... times a week. The database will be made available free of charge to inter- ested parties. Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon A1 A2 A3 A4 x A4 y Amplification ... A4 y Amplification efficiency 95 a 98 93 10 0 95 Average efficiency 96.2 Genotype 1b Amplicon A1 x A1 y A2 A3 A4 x A4 y Amplification efficiency 10 0 10 0 93 93 10 0 10 0 Average efficiency 97.7 a Amplification ... 11 ):23 91- 2399. 11 . Martell M, Esteban JI, Quer J, Genesca J, Weiner A, Esteban R, Guar- dia J, Gomez J: Hepatitis C virus (HCV) circulates as a popula- Additional File 1 Primers for amplification...
Ngày tải lên: 20/06/2014, 04:20
... primers: Aba, 5Â-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3Â;Abb, 5Â-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3Â;Abc, 5Â-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3Â;Ab- start, ... 5Â-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3Â;Ab- start, 5Â-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3Â;Abstop, 5Â-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3Â. The PCR solution was prepared in the buffer supplied with ... than A b40 [32–34]. The morphol- ogy of aggregates formed after incubation times when the aggregation had reached a maximum [5 h for Ab(M1–40) and Ab (1 40) and 80 min for Ab(M1–42) and Ab (1 42)]...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5Â-CTC GAGATGGATAAAGTTTTAAACAGAG-3Â and LTA- 1R, 5Â-TGAAGGCAAATCTCTGGAC-3Â for ... 250 kDa 15 0 kDa 10 0 kDa 10 0 kDa 75 kDa 50 kDa 10 0 kDa 75 kDa Lyve -1 Prox -1 VEGFR-3 tsA58 T Ag / tublin Lyve -1 DaAPI DaAPI Lyve -1 Prox -1 CDa 31 DaAPI Magnetic A B C D E immunosorting ... Oreda B et al. (2003) The conditional inactivation of the beta-catenin gene in endothelial cells causes a defective vascular pattern and increased vascular fragility. J Cell Biol 16 2, 11 11 11 22. 8...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx
... times a week. The database will be made available free of charge to inter- ested parties. Table 7: Amplification efficiency for patients' amplicons Genotype 1a Amplicon A1 A2 A3 A4 x A4 y Amplification ... A4 y Amplification efficiency 95 a 98 93 10 0 95 Average efficiency 96.2 Genotype 1b Amplicon A1 x A1 y A2 A3 A4 x A4 y Amplification efficiency 10 0 10 0 93 93 10 0 10 0 Average efficiency 97.7 a Amplification ... until at least three pairs of optimized prim- ers were available for each amplicon. Table 1 (see additional file 1: HCVMethodPaperTable1.xls) and Table 2 (see additional file 2: HCVMethodPaperTable2.xls)...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf
... 0.002688753 419 7 61 25 −0.002233 814 412 328 −0. 010 187262429483 −0. 018 3570 616 17550 −0. 012 518 72 619 76 41 −0.0 018 8023 410 3 510 26 0.0 016 19 612 427739 0.007 614 467 619 845 0. 013 993527079620 0.0094949278220 61 0.0 012 517 243 314 96 27 −0.0 011 49754797462 ... 0.22090 513 1 511 245 0 .11 260506328 312 7 0.020 710 959749977 11 −0.055295700680 418 −0 .16 68869 210 64048 −0.2 018 5 812 5775743 −0 .10 92474 813 40844 −0.0 216 90925658959 12 0.045994562958 711 0 .14 40486 414 08887 0 .18 2424468 016 734 ... 0 .18 2424468 016 734 0 .10 3 618 709 513 285 0.0 216 816 89765273 13 −0.03 816 262 612 60 81 −0 .12 3683 810 542076 −0 .16 316 5397984585 −0.096 416 215 678346 −0.020903696245568 14 0.0 315 43 613 4805 51 0 .10 556 811 3889007 0 .14 4488637747372...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf
... that R min,i +1 = P min,i +1 Π i +1 log 1+ Π i +1 N i +1 (A. 8) < P min,i +1 Π i +1 log 1+ Π i +1 N i +1 (A. 9) < P min,i +1 Π i +1 log 1+ Π i +1 N i +1 (A. 10 ) = R min,i +1 . (A. 11 ) In ... 395763, 10 pages doi :10 .11 55/2 010 /395763 Research Article A Novel Method for Improving Fairness over Multiaccess Channels Seyed Alireza Razavi and Ciprian Doru Giurc ˘ aneanu Department of Signal ... holds: 1 b log 1+ b c < 1 a log 1+ a c . (A. 1) (ii) For a, b, c, d>0 that satisfy simultaneously the conditions a& gt;band a + c = b + d,wehave 1 b log 1+ b d < 1 a log 1+ a c . (A. 2) Proof. For an arbitrary...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: "Research Article A Computationally Efficient Method for Polyphonic Pitch Estimation" pdf
... 729494, 11 pages doi :10 .11 55/2009/729494 Research Article A Computationally Efficient Method for Polyphonic Pitch Estimation Ruohua Zhou, 1 Joshua D. Reiss, 1 Marco Mattavelli, 2 and Giorgio Zoia 2, ... 2006. [13 ] M. Davy and S. J. Godsill, “Bayesian harmonic models for musical signal analysis,” Bayesian Statistics, vol. 7, pp. 10 5 12 4, 2003. [14 ] S. A. Abdallah and M. D. Plumbley, “Unsupervised analysis of ... filter bank, it is faster than any other filter-bank- based implementation. The Fast RTFI is also compared with transform-based implementations as follows. So as to use a constant-Q transform for a...
Ngày tải lên: 21/06/2014, 19:20
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
Ngày tải lên: 23/06/2014, 01:20
Everyone Is a Customer - A Proven Method for Measuring the Value of Every Relationship in the Era of Collaborative Business pdf
Ngày tải lên: 28/06/2014, 22:20
Báo cáo toán học: "A construction method for complete sets of mutually orthogonal frequency squares" pdf
Ngày tải lên: 07/08/2014, 06:20
Báo cáo khoa hoc:" A rapid method for computing the inverse of the gametic covariance matrix between relatives for a marked " pdf
Ngày tải lên: 09/08/2014, 18:21
everyone is a customer a proven method for measuring the value of every relationship in the era of collaborati phần 5 pdf
Ngày tải lên: 10/08/2014, 11:20
Báo cáo y học: "Immobilized pH gradient-driven paper-based IEF: a new method for fractionating complex peptide mixtures before MS analysis" pdf
Ngày tải lên: 13/08/2014, 13:20
Tài liệu Building a Cisco Network for Windows 2000 P1 pdf
... Catalyst 5000 409 Software Features of the Catalyst 5xxx Series 410 Catalyst 6000 410 Hardware Features of the Catalyst 6xxx Series 410 Software Features of the Catalyst 6000 Series 411 Catalyst ... not be able to accom- plish the goals he has set for himself. Stace Cunningham authored a chapter in addition to acting as technical director for the book. 71_ BCNW2K_FM 9 /10 /00 11 :57 AM Page viii ... read the Internet history in Chapter 1, by Preface xxi 71_ BCNW2K_preface 9 /10 /00 11 :53 AM Page xxi 71_ BCNW2K_preface 9 /10 /00 11 :53 AM Page xxvi CISCO NETWORK WINDOWS 2000 BUILDING A FOR 71_ BCNW2K_FM...
Ngày tải lên: 23/12/2013, 01:16
Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf
... Ortiz-Martinez, L. A. Leiva, V. Alabau, I. Garcia-Varea, and F. Casacuberta. 2 011 . An interactive machine translation system with online learning. In Proceedings of ACL System Demonstrations, pages ... participants found TransAhead suggestions satisfying, accepted, and learned from them; c) interactivity made translation and language learning more fun and the participants found TransAhead ... ++ III, Taipei, Taiwan, R.O.C. + CS, NTHU, HsinChu, Taiwan, R.O.C. {u9 015 71, maciaclark,chen.meihua,vincent732,maxis1 718 ,jason.jschang}gmail.com Abstract We introduce a method for learning...
Ngày tải lên: 22/02/2014, 03:20
Tài liệu A Science Roadmap for Food and Agriculture pdf
... p A Science Roadmap for Food and Agriculture 2 p A Science Roadmap for Food and Agriculture 16 p A Science Roadmap for Food and Agriculture Grand Challenge 1 hollowing-out will continue, and ... economic data are needed to provide more accurate estimates of climate change impacts, the potential costs and benets of adaptation, and to validate and calibrate models. ã Quantify costs and benets ... given that regional variations in soils and climate are large and that there are a number of potential bioenergy crops, along with algae, that can be considered. This complexity mandates an integrated...
Ngày tải lên: 22/02/2014, 05:20