a model to study inflammatory diseases

... either to proinflammatory or anti -inflammatory compounds together with or without LPS induction at DIV As a proinflammatory stimulus we used trichostatin A (TSA, 20 nM), a well characterised histone ... respectively, according to the manufacturer's protocol LDH leakage to the culture medium was measured with a CytoTox 96 nonradioactive cytotoxicity assay kit obtained from Promega (Madison, WI, USA) The ... preparation of manuscript AS aided in study design, especially with regards to inflammatory experiments, supervised all experiments and helped to draft the manuscript All authors read and approved...

Ngày tải lên: 19/06/2014, 22:20

... high, saturated genetic maps would be necessary to have very close markers available each time in order to permit a molecular marker-assisted selection The current genetic maps contain around ... of around 80 chromosomes separated into two classes: a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and ... genetic maps For this purpose, a collection of large insert BAC (bacterial artificial chromosome) and PAC (bacteriophage PI artificial chromosome) clones [80] to be used as microchromosome tags for...

Ngày tải lên: 09/08/2014, 18:21

... was then added to each well, incubated at room temperature for 10 minutes, after which the optical density was read using a microplate reader set at 630 nm Statistical analysis All data are presented ... experimental animal for our research Results of this study demonstrate that PCV2 can replicate in Kunming mouse Kiupel [10] demonstrated that PCV2 was capable of replicating in BALB/c mice and caused ... has taken at least days for the PCV2 to be transferred into other organs from the primary interface It seems that the diffusion to thymus had been retarded for days The replication of PCV2 can...

Ngày tải lên: 12/08/2014, 04:20

Ngày tải lên: 04/10/2012, 10:24

... A3 A3 A3 A3 A2 A2 A2 A2 A1 Eye Car e Tr aining Modules H2 A1 A1 A1 Eye car e nur se Catar act sur geon Optometr ist Ophthalmologist Figure Example1of the use of a proposed modular training system ... for a planner to integrate all the interactions in a meaningful way To overcome this problem and to reduce uncertainty, a computable dynamic model is proposed from which a number of scenarios can ... immediate neighbours and the system as a whole The inclusion of feedback and temporal features makes the model dynamic and non-linear rather than static and linear Nurse, ophthalmology and community...

Ngày tải lên: 18/06/2014, 17:20

... Ras Another ability that is acquired by mammalian tumors is degradation of basement membranes Using an antibody to detect laminin and a collagen IV-GFP fusion protein to detect basement membranes, ... proliferation and metastasis [9,10] Scrib is an adaptor protein containing multiple PDZ domains (which enable binding to a variety of other proteins); it is localized to basolateral membranes of ... Richardson group [9] tested whether other signaling pathways can cause scrib mutant cells to metastasize They found that activation of the signaling pathways initiated by any of the extracellular...

Ngày tải lên: 09/08/2014, 20:20

... resistance: A metabolic pathway to disease Hepatology 2005, 42:987-1000 Lonardo A, Lombardini S, Ricchi M, Scaglioni F, Loria P: Review article: hepatic steatosis and insulin resistance Aliment Pharmacol ... the study Blood plasma was analysed for glucose, FFA and insulin as previously described [9] RQUICKI was calculated as described by Perseghin et al [7] Before statistical analysis, the data were ... that study the influence of body condition at parturition on metabolism and performance during lactation was investigated Body condition was evaluated as described by Agenäs et al [10] and FFA,...

Ngày tải lên: 12/08/2014, 18:22

... treatment (Figure 2) TGCTTTCGGAGCGTATATC CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG CCGTGAGCCACTTCCATTAT GGGTCATCATCTCTGCTCCT ... Folgueira MAAK, Carraro DM, Brentani H, Patrão DFC, Barbosa EM, Netto MM, Caldeira JRF, Katayama MLH, Soares FA, Oliveira CT, Reis LFL, Kaiano JHL, Camargo LP, Vêncio RZN, Snitcovsky IML, Makdissi ... increased clinical response rates were associated with high histological grade [27,28] The histological grade seems to be of prognostic value in canine mammary carcinoma patients as in human patients...

Ngày tải lên: 12/08/2014, 18:22

... non-linear and potentially paradoxical behavior [7,16,19] In order to aid in the qualitative characterization and examination of this relationship, we introduce the BIS, an agent-based model (ABM) based ... the access of the agents to Zone They also transmit signals produced in Zones and to attract agents to migrate The Portals also participate in the transport of some signals to Zone Portals are a ... it critically for important intellectual content The living authors, VAF and GCA, read and approved the final manuscript Additional material Additional file State diagram key A key to the symbols...

Ngày tải lên: 13/08/2014, 16:21

... expectancies about a particular behavior in a given setting and can be operationalized as the likelihood to act (Fishbein & Ajzen, 1975) In a study of potential travelers from mainland Korea to Jinju, Lam ... and the harbor, as well as to take advantages of various shopping malls The renowned Lan Kwai Fong area is located at the center of the bustling city, which houses many international restaurants, ... (CBs) to 0.91 (attitude), above the generally agreed upon lower limit of 0.70 (Hair, Anderson, Tatham, & Black, 2002) The scales can be used for analysis with acceptable reliability Factor analysis...

Ngày tải lên: 06/08/2016, 20:50

... were applied A statistical model called multivariate linear mixed-effect model was applied to data established in three independent experiments as an illustrative example Multivariate linear mixed-effects ... that in a range from approximately 21-25C, temperature only had a modest effect on performance Tools to assess performance A performance tool can be defined as a tool or calculation method that ... for each indoor factor that varies) In practice, this is time consuming and difficult to do, so average assumptions are often applied A probabilistic model may be a more appropriate and an easier...

Ngày tải lên: 12/12/2016, 20:32

... thickness and inflammatory infiltration of synovial membrane in (b) and a normal appearance in (a) White arrows show depletion of proteoglycan (a marker for cartilage destruction) in (d) and a normal ... the statistical analysis DZ shared responsibility for manuscript preparation EA helped to perform the animal experiments ML performed the ELISA and L929 cytotoxic assay All authors read and approved ... were analyzed considering the area under the curve for each subject as a summary measure; these measures were then analyzed as raw data [19] According to data distribution and number of groups, a...

Ngày tải lên: 12/08/2014, 11:22

... all kinetoplastid CTs are unusual fusion proteins in having a cytidylyltransferase domain fused to a CDP-alcohol phosphatidyltransferase domain that is normally found in CEPT and CDP-ethanolamine:diacylglycerol ... in a mutant strain of Saccharomyces cerevisiae by the AUR1 gene J Biol Chem 272, 9809–9817 Kuroda M, Hashida-Okado T, Yasumoto R, Gomi K, Kato I & Takesako K (1999) An aureobasidin A resistance ... palmitoyl-CoA to form 3-ketosphinganine, a reaction catalysed by serine palmitoyltransferase After reduction of the product, dihydrosphinganine is N-acylated to dihydroceramide by a family of ceramide...

Ngày tải lên: 28/03/2014, 23:20

... between changes in functional ability and changes in general health Similarly, if specific functional activities are considered an important element of day to day usual activities, an association ... not; and ii) the importance attached to the single activity (Q2) Q1 and Q3 – Data were available for both items on 396 patients at baseline, and 300 at 12 months follow-up A summary of these data ... upon a broad amalgam of experiences e.g Assessment of general health status or overall change in condition Usual activities (spanning a range of functional tasks) Patient-identified single activities...

Ngày tải lên: 18/06/2014, 19:20

... Arthritis Research & Therapy Vol 10 No Vonkeman et al with NSAIDs) with the appropriate pharmacoeconomic information Materials and methods The pharmacoeconomic evaluation was linked to a 26-month ... intensive care and standard care in-patient days, emergency department care, ambulance transportation, transfusion of blood products, endoscopies, surgery, (radio)diagnostic procedures, and laboratory ... pulmonary disease; COX, cyclooxygenase; H2RA, histamine receptor-2 antagonist; NSAID, non-steroidal anti -inflammatory drug; OA, osteoarthritis; OR, unadjusted odds ratio; SSRI, selective serotonin...

Ngày tải lên: 09/08/2014, 01:22

... Arthritis Research & Therapy Vol 10 No Vonkeman et al with NSAIDs) with the appropriate pharmacoeconomic information Materials and methods The pharmacoeconomic evaluation was linked to a 26-month ... intensive care and standard care in-patient days, emergency department care, ambulance transportation, transfusion of blood products, endoscopies, surgery, (radio)diagnostic procedures, and laboratory ... pulmonary disease; COX, cyclooxygenase; H2RA, histamine receptor-2 antagonist; NSAID, non-steroidal anti -inflammatory drug; OA, osteoarthritis; OR, unadjusted odds ratio; SSRI, selective serotonin...

Ngày tải lên: 09/08/2014, 13:22

... Pearson partial correlations for confounding variables were used to evaluate the age adjusted association between the various components of the MetS and the inflammatory variables In order to assess ... data organization and retrieval, English editing and final draft preparation All of the authors have read and approved the final manuscript Competing interests The authors declare that they have ... aspirin, as well as hormone replacement therapy or oral contraceptives in females In an attempt to adjust for the association between the inflammatory variables (mainly hs-CRP) and obesity, we repeated...

Ngày tải lên: 11/08/2014, 03:20

... Survey, ABS Cause of Death statistics etc Administrative data sets Hospital data bases Inpatient minimum datasets, Outpatient minimum datasets Medicare data Medical services MBS (Medical Benefits ... Australia Adelaide; 1999 Australian Institute of Health and Welfare (AIHW): Diabetes management and the allied health workforce: An overview of workforce mapping techniques and related data issues ... of the model An example of pertinent data sources for Australia that can be used to determine population health status are listed in Table The ability to implement the model in a way that is truly...

Ngày tải lên: 11/08/2014, 05:21

... Pearson partial correlations for confounding variables were used to evaluate the age adjusted association between the various components of the MetS and the inflammatory variables In order to assess ... data organization and retrieval, English editing and final draft preparation All of the authors have read and approved the final manuscript Competing interests The authors declare that they have ... aspirin, as well as hormone replacement therapy or oral contraceptives in females In an attempt to adjust for the association between the inflammatory variables (mainly hs-CRP) and obesity, we repeated...

Ngày tải lên: 11/08/2014, 06:22