a model or valuable foundation for other diseases

... Dulay and Marina K Burt 1975 Natural sequences in child second language acquisition Language Learning, 24(1) Susan Gass 1979 Language transfer and universal grammatical relations Language Learning, ... students’ performance at each level Tagging all sentences for the correct structures, however, is an intractable task for a human coder On the other hand, while it is feasible to have this information ... namely, indicating which features are typically acquired before other features, and which are typically acquired at the same time With this information available in the model, SLALOM will be able to...

Ngày tải lên: 17/03/2014, 07:20

... principal investigators 12 in pancreatic cancer, who are each an as- 13 sistant-level professor in a major academic 14 research institution and who have each re- 15 ceived at least grant from the National ... rector of the National Cancer Institute in ac- cordance with paragraph (5) regarding the prioritization and award of National Institutes of Health research grants relating to pancreatic 10 cancer ... determines appro- priate ‘‘(2) DEFINITION.—The term ‘relevant patient advocate and physician organization’ means a na- tionwide organization that— ‘‘ (A) provides evidence-based disease infor- 10 mation...

Ngày tải lên: 22/03/2014, 17:20

... CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune MedImmune Inspire Pharmaceuticals Genital Warts HPV Hepatitis B Hepatitis B Hepatitis ... [17,18] As such, ICAM1 has become a very promising target for biochemical prevention A receptor blocking approach has shown that the soluble ICAM-1 and an anti-ICAM-1 monoclonal antibody, Mab 1A6 , ... OraQuick HIV-1 Cytolin Tipranavir HXB MEDI-491 Synagis™ (Palivizumab) Numax INS37217 Intranasal MedImmune Nabi Biopharmaceuticals Protein Design Labs XTL Biopharmaceuticals Ltd Nabi Biopharmaceuticals...

Ngày tải lên: 18/06/2014, 22:20

... CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune MedImmune Inspire Pharmaceuticals Genital Warts HPV Hepatitis B Hepatitis B Hepatitis ... [17,18] As such, ICAM1 has become a very promising target for biochemical prevention A receptor blocking approach has shown that the soluble ICAM-1 and an anti-ICAM-1 monoclonal antibody, Mab 1A6 , ... OraQuick HIV-1 Cytolin Tipranavir HXB MEDI-491 Synagis™ (Palivizumab) Numax INS37217 Intranasal MedImmune Nabi Biopharmaceuticals Protein Design Labs XTL Biopharmaceuticals Ltd Nabi Biopharmaceuticals...

Ngày tải lên: 20/06/2014, 04:20

... Learning AEHS Adaptive Educational Hypermedia System AeLS Adaptive e-Learning System AHS Adaptive Hypermedia System AI-CAI Adaptive Intelligent- Computer-Assisted Instruction AI-Edu Artificial ... PHỤ LỤC - ACeLF hệ học trực tuyến 167 DANH MỤC CÁC TỪ/THUẬT NGỮ VIẾT TẮT ACeLF Active-Collaborative e-Learning Framework ACeLS Active-Collaborative e-Learning System ADL Advanced Distributed ... System LIP IMS Learner Information Package LMS Learning Management System LO/RLO Learning Object/Reusable Learning Object LOM Learning Object Metadata LTSC Learning Technology Standards Committee...

Ngày tải lên: 07/11/2014, 17:25

... well as acting as the coordinating body for the savings bank group In addition to its activity as a general commercial bank responsible for key customers, therefore, the National Bank now acts as ... savings banks, local authorities Local public authorities Structure of the savings bank organization Tripartite (approximately 450 local savings associations, 34 regional savings banks, National Bank ... the savings banks) Tripartite (519 local savings banks, 12 regional state banks, DekaBankDeutsche Girozentrale) Coordinating function National Bank of the savings banks State banks and DekaBank...

Ngày tải lên: 29/03/2014, 08:20

... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... Action on Aging and Physical Activity.; 2008 Available from: http://www.eunaapa.org/ [Accessed 23 January 2010] EFQM: The EFQM Framework for Managing External Resources: Driving performance and ... 70 AACVPR: Guidelines for Cardiac Rehabilitation and Secondary Prevention Programs 4th Edition edition American Association of Cardiovascular and Pulmonary Rehabilitation Champaigh, IL.: Human...

Ngày tải lên: 14/08/2014, 08:20

... selective abortion, i.e termination of pregnancy after the prenatal diagnosis of severe fetal defects was also named as secondary prevention Recently the WHO and other international bodies have excluded ... to achieve a complete recovery in 33.5% of cases with congenital abnormalities Thus, there are two main conclusions: at present the major part of congenital abnormalities (85.3%) are preventable; ... congenital cardiovascular malformations (e.g ventricular and atrial septal defects, rest of patent ductus arteriosus, etc), congenital pyloric stenosis, undescended testis, etc Tertiary prevention...

Ngày tải lên: 02/11/2012, 11:12

... Ph.D Dissertation, Stanford University, Stanford, California Pereira, Fernando C 1985 A New Characterization of Attachment Preferences In: Dowty, David R.; Kartunnen, Lauri and Zwicky, Arnold M., ... Papegaaij, Bart; Sadler, Victor and Witkam, Toon 1986 Word Expert Semantics; an Interlinqual Knowledae Based Approach Foris, Dordrecht, Holland Paxton, W.H 1977 A Framework for Speech Understanding Ph.D ... guarantee that this will be the case for the relation as a whole or for the translation steps between intermediate levels of representation (An attempt to formalize this can be found in Krauwer...

Ngày tải lên: 22/02/2014, 10:20

... Washington, DC: National Academy Press © 2013 March of Dimes Foundation Guidelines and References Page Preconception Health Promotion: The Foundation for a Healthier Tomorrow Jack, B.W & Atrash, ... adverse perinatal outcomes: A meta-analysis Journal of the American Medical Association (JAMA), 295, 1809-1823 © 2013 March of Dimes Foundation Guidelines and References Page Preconception Health Promotion: ... Recommendations for improving preconception health and health care: United States: A report of the CDC/ATSDR Preconception Care Workgroup and the Select Panel on Preconception Care Morbidity Mortality...

Ngày tải lên: 05/03/2014, 15:20

... amyloid formation pathways, any sequence able to be accommodated in a b-sheet conformation can, potentially, reach the amyloid state [51,56] Amyloid-like properties of bacterial IBs Protein aggregation ... morphological characteristics: straight The architecture and mechanisms of IB formation in bacteria have remained unexplored for years However, important insights in this field have lately emerged Although ... with an ICREA Academia award References Ferrer-Miralles N, Domingo-Espin J, Corchero JL, Vazquez E & Villaverde A (2009) Microbial factories for recombinant pharmaceuticals Microb Cell Fact 8,...

Ngày tải lên: 06/03/2014, 00:20

... Institute for Corporate Ethics objectives, and themes for MBA programs; isolates leading practices as well as the major challenges and areas for improvement; and moves the conversation around envisioning ... administration is particularly helpful in this area The Markkula Center for Applied Ethics at Santa Clara University offers a program inviting faculty to apply for assistance with incorporating ... three normative criteria for measuring group and organizational performance.25 Administrators and business ethics program faculty can use the criteria to assess their progress and how they are doing...

Ngày tải lên: 06/03/2014, 19:20

... Research Projects Activity (IARPA), through the Army Research Laboratory Jordan Boyd-Graber and Philip Resnik are also supported by US National Science Foundation Grant NSF grant #1018625 Any opinions, ... segmentation in a support vector machine approach In Conference on Computational Natural Language Learning [Gerrish and Blei, 2010] Gerrish, S and Blei, D M (2010) A language-based approach to measuring ... because, for the first time, it had real support for alternative energy [ ] on eliminating the tax breaks for the oil companies, Barack Obama voted to eliminate them [ ] WHITMAN: Well I disagree...

Ngày tải lên: 07/03/2014, 18:20

... values The data model also supports associative relations between markables: Markable set relations associate arbitrarily many markables with each other in a transitive, undirected way The coref ... et al (2004), among others) adopt this as a metaphor for expressing the sequential and hierarchical relations between markables, and we use a set of relation operators that is inspired by (Allen, ... one or more target markables in an intransitive, directed fashion Simplified MMAXQL Simplified MMAXQL is a variant of the MMAXQL query language It offers a simpler and more concise way to formulate...

Ngày tải lên: 08/03/2014, 04:22

... have decomposed it into a path and landmarks A path is made up of transfers and relays Relays are abstract points initiating transfers and may be "covered" by a turn Landmarks can be either associated ... report 540, M.I.T Artificial Intelligence Laboratory, Cambridge, MA A Yamada, T Yamamoto, H Ikeda, T Nishida, and S Doshita 1992 Reconstructing spatial image from natural language texts In Proc ... associated with relays or with transfers More formally, a route is structured into a list of segments, each segment consisting of a relay and of a transfer Landmarks are represented as possible attributes...

Ngày tải lên: 08/03/2014, 07:20

... The median age of the male was years (range 1–10) for yearling-female pairs, years (2 –11) for yearling-female groups, years (2–11) for older-female pairs and years (1–11) for older-female groups; ... Whittingham 1997) Males in a group form a dominance hierarchy, with older males being more dominant Groups larger than pairs generally form through natal philopatry of males, although occasionally males ... supply and predator abundance, and the quality, age or experience of breeders For example, if food is abundant, a pair may be able to provide easily for optimal growth of offspring; or when predators...

Ngày tải lên: 14/03/2014, 16:20

... is called transformation Oncoviruses- mammalian viruses capable of initiating tumors Viruses that Infect Bacteria  Bacteriophage  Most contain dsDNA  Often make the bacteria they infect more ... more pathogenic for humans T-even Phages        Icosahedral capsid head containing DNA Central tube surrounded by a sheath Collar Base plate Tail pins Fibers Similar stages as animal viruses ...   Ivanovski and Beijerinck showed that a disease in tobacco was caused by a virus Loeffler and Frosch discovered an animal virus that causes foot –and-mouth disease in cattle Many years of...

Ngày tải lên: 15/03/2014, 12:58

... QuickChange method (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC GGT GAT ... samples, A Padovani for making the W56F variant and J A Kornblatt for encouragement and advice Financial support was provided by the Natural Sciences and Engineering Research Council of Canada 12 13 ... was increased by approximately 103 for the G376E variant: at mgÆmL)1 and 15 °C, the protein was partially dissociated The Kd value for the G157D variant was also increased, but by a smaller amount,...

Ngày tải lên: 16/03/2014, 06:20

... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC ... GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG GCCGGGATCCTAGGGCGAATTGGGTACC Ó FEBS 2004 Analysis of the ... AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC...

Ngày tải lên: 16/03/2014, 16:20