a model for genetic analysis of endometrial carcinoma

... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... expression of Ki-67 antigen and of cleaved caspase-3 expression in human NSCLC specimens of both adenocarcinoma and squamous cell carcinoma type Data are expressed as mean values of percentages ± ... TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been correlated to actual patient...

Ngày tải lên: 12/08/2014, 15:20

... 17(1):43–75 Masaki Murata, Kiyotaka Uchimoto, Qing Ma, Toshiyuki Kanamaru, and Hitoshi Isahara 2005 Analysis of machine translation systems’ errors in tense, aspect, and modality In Proceedings of PACLIC ... identify statistical machine translation errors In Proceedings of EAMT, pages 52–57, Saint Rapha¨ l, France e 61 Mary Flanagan 1994 Error classification for MT evaluation In Proceedings of AMTA, pages ... Philadelphia, Pennsylvania, USA Maja Popovi´ , Adri` de Gisper, Deepa Gupta, Patrik c a Lambert, Hermann Ney, Jos´ Mari˜ o, and Rafael e n Banchs 2006 Morpho-syntactic information for automatic...

Ngày tải lên: 07/03/2014, 22:20

... chemical compound names, name normalization is a possible approach Rules can be set up to transform syntactic as well as morphological variations of names into a normalized name form Basic transformations ... constraints over a collection of variables Each of the variables has a domain, which is the set of possible values the variable can take For the reasons named above, we are working with graph variables ... CompLife, pages 107–118 Kirill Degtyarenko, Paula de Matos, Marcus Ennis, Janna Hastings, Martin Zbinden, Alan McNaught, Rafael Alc´ ntara, Michael Darsow, Micka¨ l Guedj, a e and Michael Ashburner...

Ngày tải lên: 08/03/2014, 01:20

... the parser has to simultaneously perform two tasks: Searching for a path to be analysed and analysing it as well If the analysis procedure is too liberal, it may already accept and analyse an ungrammatical ... length and coverage of the individual analyses The length is defined as the length of the temporal interval an analysis spans; an analysis with a greater length is preferred The coverage of an analysis ... semantic predicates, a list of scopal constraints, syntactic, prosodic and pragmatic information as well as tense and aspect and sortal information An example of a VIT for the sentence Montag ist gut...

Ngày tải lên: 17/03/2014, 07:20

... http://scholar.sun.ac.za democracy, can help parliaments to become more transparent, accessible, accountable and effective in promoting democracy e-Parliament enables automation of parliamentary information ... many parliaments lack a strategic plan, an adequate ICT infrastructure, basic tools for Members of Parliament and staff, systems for managing documents and trained ICT staff The status of the ... e-democracy The thesis will provide a critical analysis of e-parliament strategies in some countries’ parliaments Further, through an analysis of some of the countries’ parliaments that have e-parliament...

Ngày tải lên: 10/05/2014, 16:26

... 86°C Human IL-8 5'GCCAAGAGAATATCCG AACT-3' 5'AGGCACAGTGGAACAA GGACTTGT-3' [GenBank: NM_000584] 60°C 78°C Bovine MMP-1 5'CAAGAGCAGATGTGGA CCAA-3' 5'CTGGTTGAAAAGCATG AGCA-3' [GenBank: NM_174112] 61°C ... processed for mRNA analysis of the SFB layer and cartilage For each experimental parameter, patient SFB were analysed separately for each donor After 14 days of in vitro co-culture, multiple layers of ... 5'TCATCCTCTTCCATGAG ACACTCTA-3' 5'ATTCTGCTGGCAGAT ACTGGCATAA-3' [GenBank: NM_000034] 58°C 88°C Human MMP-1 5'GACCTGGAGGAAATCT TGC-3' 5'GTTAGCTTACTGTCACA CGC-3' [GenBank: NM_002421] 58°C 86°C Human...

Ngày tải lên: 09/08/2014, 01:22

... 399:130-132 Banavar JR, Damuth J, Maritan A, Rinaldo A: Supply-demand balance and metabolic scaling Proc Natl Acad Sci USA 2002, 99:10506-10509 Darveau C -A, Suarez RK, Andrews RD, Hochachka PW: Allometric ... conceptualization has also been used to develop a five-compartment anatomical model (brain, liver, kidney, heart and all other organs) as an explanation for Kleiber's law [28] The anatomical con- Page ... midpoint of the values of ki plus the midpoint of the values of bi because values of ki are not available for certain tissues For scaling of the brain and the epithelial tissues of the skin and gastrointestinal...

Ngày tải lên: 13/08/2014, 23:20

... systematic and random effects, respectively Implementation of this model in a Bayesian analysis using data augmentation became feasible after Albert and Chib [2] and Sorensen et al [15] All pertinent ... demonstrates the feasibility and advantage of a longitudinal analysis of sequential binary responses A random regression model proved to be superior than a model with constant genetic value over ... than a single predicted additive genetic value for a cow Furthermore, longitudinal data analysis accounts for the number of episodes of mastitis along lactation as well as their timing Relaxing...

Ngày tải lên: 14/08/2014, 13:22

... distribbution along span at loadd levell of 122 kN Fiig.19 Strain profile alongg the span inn the bottom flange at load level of 122 kN CONCLUSIONS A numeerical modell for the lineear analysis and nonlineear ... CB E11 (Chapman et al 1964) The nonlinear anallysis of simpply supporteed beam E1 was carried out, based d on the tessted beam of Chapman C et al a (1964) Shear S connecctors are heaaded studs ... 8DOF mo odel (Dall A Asta and Zoona 2002) and a s fouur elements are used, annd two morre elements are experimenntal data Beetween the supports, placed at the t beam endds Tablee 2: Mechaniical...

Ngày tải lên: 03/06/2016, 19:11

... performance database was designed to store the majority of the data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... 45 5.1 Data Analysis 45 5.2 Soil Temperature and Moisture Behaviour 51 5.3 Regression Analysis of Subgrade Temperature Variations 60 5.4 Analysis of Resilient Modulus 67 5.5 Damage Analysis 75 ... and prayers, I appreciate you mama and papa and my faithful wife, Olorunfumi you are special and loved v TABLE OF CONTENTS Page Title Page i Abstract ii Dedication iv Acknowledgement v List of...

Ngày tải lên: 04/07/2016, 17:20

... accuracy of latter input values is also of major importance Therefore, an adequate calculation method for the actual values of [LaH] and pH at each time point during growth is necessary According ... a more theoretical analysis of the model Some mathematical properties of the model are discussed, and an easy-to-use method to take into account the evolution of pH and undissociated lactic acid ... same values for the parameters [LaH]min, a, b and KLaH as mentioned in Nicolaı et al (1993), (iii) a value of ¨ 0.6920 [h À 1] for the parameter lmax (which corresponds with the value of lmax...

Ngày tải lên: 05/05/2014, 08:44

... explore the genetic variability of these traits and to create extreme phenotypes allowing the analysis of underlying mechanisms and the search for new genetic markers of disease resistance traits Such ... 66 M.-H Pinard-van der Laan et al INTRODUCTION For the analysis of genetic control of health traits in domestic animals, there is a growing interest for selection experiments as a powerful tool ... are particularly developed in the chicken for the analysis of immunoresponsiveness [31] or resistance to specific diseases [3] Resistance to viral diseases are examples of traits for which a genetic...

Ngày tải lên: 14/08/2014, 13:22

... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... slightly lower mean rates of carbon uptake before and during the first day of cold acclimation After days of cold exposure, the mean rate of carbon uptake was significantly lower for C24 than for Rsch ... exchange measurement Exchange rates of CO2 were measured with an infrared gas analysis system (Uras G; Hartmann & Braun AG, Frankfurt am Main, Germany) A whole-rosette cuvette design was used as...

Ngày tải lên: 14/02/2014, 22:20

... use of these underestimated bacterial aggregates as intriguing models for the analysis of protein–protein interactions in the context of amyloid and prion diseases Dynamics of IB formation and ... amyloid formation pathways, any sequence able to be accommodated in a b-sheet conformation can, potentially, reach the amyloid state [51,56] Amyloid-like properties of bacterial IBs Protein aggregation ... E Garc a- Fruitos et al Biological role of bacterial inclusion bodies A B Fig A nucleation ⁄ polymerization selfassembly process drives the formation of IBs in bacteria (A) In vivo formation of...

Ngày tải lên: 06/03/2014, 00:20

... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... International Conference on Computational Linguistics, pp.218-224 COLING-ACL’98 Lance A Ramshaw and Michael P Marcus ( In Press) Text chunking using transformation-based learning In Natural Language ... sequences, parameters (3) and (4) can be calculated, The calculation formulas are similar with equations (13) and (14) respectively Before training trigram model (3), all possible baseNP rules...

Ngày tải lên: 08/03/2014, 05:20

... occupy an area of 40 ha, of which 27 are planted with native Australian plants Most of the remainder is natural woodland, which is contiguous with the woodland of Canberra Nature Park The birds are ... was used on group size and territory quality (categorical variables), and male age and age squared (continuous variables) Age and age-squared were used in case the effect of male age was not a ... natal philopatry of males, although occasionally males immigrate into groups as subordinates ( Magrath & Whittingham 1997) Females always disperse from their natal group before or at the onset of...

Ngày tải lên: 14/03/2014, 16:20

... QuickChange method (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC GGT GAT ... Genomics) for running many of the analytical ultracentrifugation samples, A Padovani for making the W56F variant and J A Kornblatt for encouragement and advice Financial support was provided by the Natural ... temperature denaturation, any change at these positions was destabilizing G37 6A and G376E had identical Tm values At position 157, alanine had a smaller effect than aspartate, but even alanine decreased...

Ngày tải lên: 16/03/2014, 06:20

... t a n d a r d ' and E r r o r Analysis For the evaluation of Cass-SWE we use three types of texts: (i) a sample taken from a manually annotated Swedish corpus of 100,000 words with grammatical ... information as well as grammatical functions in the output A corpus, annotated syntactically, is a rich source of information which we intend to use for a number of applications, e.g information ... Proceedings of EACL '99 general description of Swedish grammar was presented Its algorithmic details were unclear, and we are unaware of any descriptions in the literature of large scale applications...

Ngày tải lên: 17/03/2014, 22:20

... designated as a a, head±tail, and b±b The a a dimer has a diad and is characterized as helix-helix packing between the two monomers, as shown in Fig 2A The head±tail dimer is formed by a crystallographic ... (1993) Interaction between staphylokinase, plasmin(ogen), and alpha2-antiplasmin Recycling of staphylokinase after neutralization of the plasmin-staphylokinase complex by alpha2-antiplasmin J Biol ... 1.4 A added to the van der Waals radius Dimer model Buried surface Ê area (A2 ) Hydrogen bonds Salt bridges A 77Arg A 65Glu A 65Glu A 61Glu A 58Glu None P212121 a a 1009 A 65Glu OE1±B 62Tyr OH, A...

Ngày tải lên: 23/03/2014, 21:21

... neither photoaf®nity labeled by a dioxin analog, nor activated by b-naphto¯avone in a yeast system [20]; the rainbow trout AhRa that binds TCDD [21] and the Microgadus Tomcod AhR also activated by ... 13 Altschul, S.F., Madden, T.L., Scha€er, A. A., Zhang, J., Zhang, Z., È Miller, W & Lipman, D.J (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs Nucleic Acids ... RESULTS AND DISCUSSION Structure prediction Application of a recursive PSI-BLAST [13] search (default parameters) against the nonredundant protein sequence database revealed a high number of matches...

Ngày tải lên: 24/03/2014, 00:21