a model for characterizing antidepressant activity in mice
Báo cáo hóa học: " Melanoma: A model for testing new agents in combination therapies" doc
Ngày tải lên :
18/06/2014, 16:20
... dacarbazine with interferon alpha-2b versus dacarbazine with tamoxifen versus dacarbazine with interferon alpha-2b and tamoxifen in patients with metastatic malignant melanoma: an Eastern Cooperative ... Eggermont AM: Interferon alfa- 2a and interleukin-2 with or without cisplatin in metastatic melanoma: a randomized trial of the European Organization for Research and Treatment of Cancer Melanoma Cooperative ... trial of the treatment of patients with metastatic melanoma using chemotherapy with cisplatin, dacarbazine, and tamoxifen alone or in combination with interleukin-2 and interferon alfa-2b J Clin...
- 7
- 449
- 0
Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx
Ngày tải lên :
09/08/2014, 23:20
... the families Viperidae (for example, rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research ... comparative data to estimate genomic characteristics of the ancestral amniote genome Page of (or the ancestral squamate genome) would be fascinating, including estimation of ancestral gene family ... Justification and strategies for expansion of snake genomics Research incorporating snakes as model systems is becoming increasingly popular and diverse in its breadth of topics The availability of...
- 8
- 410
- 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
Ngày tải lên :
19/02/2014, 18:20
... reaction the sulfonation reagent, is present at its N-terminus instead of a free amino group [32] Therefore, the asparagine in position 26 was labeled within the intact protein at its a- amino ... concentration of the mL supernatant was about 25 mgÆmL)1 as measured with the Quick Start Bradford Protein Assay (BioRad, Hercules, CA, USA) using bovine serum albumin as standard It contained almost ... basic amino acids (arginine and histidine) and a blocked amino terminus should not acquire more than two positive charges in positive ion mode On the other hand, the maximal charge state of a...
- 9
- 559
- 1
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
Ngày tải lên :
22/03/2014, 17:20
... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... viral infections [20] Cancer therapy is a principal goal of the current clinical research on hESCs Recently, regression of metastatic melanoma tumors was achieved by transplantation of adaptive ... Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the field of regenerative medicine...
- 12
- 550
- 0
War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? docx
Ngày tải lên :
29/03/2014, 03:20
... War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? Summary The high costs of fighting the wars in Iraq and Afghanistan have rekindled congressional interest in ... financial institutions Today, savings bonds are almost always a substitute mechanism for other forms of personal savings Author Contact Information James M Bickley Specialist in Public Finance ... Congressional Research Service War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? Introduction The high costs of fighting the wars in Iraq and Afghanistan have rekindled...
- 7
- 361
- 0
THE REFORM OF THE SAVINGS BANK SYSTEM IN FRANCE – A MODEL FOR OTHER COUNTRIES? docx
Ngày tải lên :
29/03/2014, 08:20
... local savings associations, 34 regional savings banks, National Bank of the savings banks) Tripartite (519 local savings banks, 12 regional state banks, DekaBankDeutsche Girozentrale) Coordinating ... local savings companies at its disposal since 1999 These are not involved in the financial business but are closely associated with the savings banks in a legal and practical sense The local savings ... in France Although not independent institutions, they are invariably attached to the savings bank in the region in which they operate In this way, several savings companies are attached to each...
- 6
- 436
- 0
Báo cáo khoa học: "A Joint Model for Discovery of Aspects in Utterances" potx
Ngày tải lên :
30/03/2014, 17:20
... Domain adaptation with unlabeled data for dialog act tagging In Proc Workshop on Domain Adaptation for Natural Language Processing at the the Annual Meeting of the Association of Computational ... assigns domain/dialog-act/slot labels to each topic at each layer in the hierarchy using labeled data (explained in §4.) We represent domain and dialog act components as meta-variables of utterances ... them For example, in a local domain application, users may require information about a sub-domain (movies, hotels, etc.), and for each sub-domain, they may want to take different actions (find a...
- 9
- 417
- 0
báo cáo sinh học:" A model for integrating strategic planning and competence-based curriculum design in establishing a public health programme: the UNC Charlotte experience" doc
Ngày tải lên :
18/06/2014, 17:20
... Integration, application and practice objectives are one area where practica and capstones (theses or projects) can serve a critical catch-all role, in much the same way as qualifying exams for ... strategic planning approach Assess and align mission The newly created Department of Health Behavior and Administration was charged with administering two existing graduate degree programmes (Master ... program graduates – Program • Define the program’s academic goals and primary objectives Specify educational strategies/approaches • Define key educational strategies and approaches needed to achieve...
- 10
- 577
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
Ngày tải lên :
18/06/2014, 18:20
... filovirus infection, indicators of liver health such as alanine transaminase (ALT) and aspartate transaminase (AST) function increased as the MARV disease progressed (Figure 2E–F) As shown by the total ... Blood urea nitrogen (BUN), (D) glucose (E) alanine transaminase (ALT), and (F) aspartate transaminase (AST) were measured at the indicated timepoints using serum collected by terminal cardiac puncture ... Mouse adaptation The general approach to adapt MARV to mice was based on virus passage in scid (BALB/c background) mice to avoid usage of suckling mice to develop a lethal mouseadapted Marburg...
- 13
- 456
- 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
Ngày tải lên :
20/06/2014, 01:20
... filovirus infection, indicators of liver health such as alanine transaminase (ALT) and aspartate transaminase (AST) function increased as the MARV disease progressed (Figure 2E–F) As shown by the total ... Blood urea nitrogen (BUN), (D) glucose (E) alanine transaminase (ALT), and (F) aspartate transaminase (AST) were measured at the indicated timepoints using serum collected by terminal cardiac puncture ... Mouse adaptation The general approach to adapt MARV to mice was based on virus passage in scid (BALB/c background) mice to avoid usage of suckling mice to develop a lethal mouseadapted Marburg...
- 13
- 431
- 0
Báo cáo lâm nghiệp: "A stochastic height-diameter model for maritime pine ecoregions in Galicia (northwestern Spain)" doc
Ngày tải lên :
08/08/2014, 00:22
... the thinning; Ga and Gb are the stand basal area after and before thinning, respectively; At is the stand age at thinning; A is the stand age at prediction and α is the parameter to be estimated ... fitted individually for each sample plot; then in a second stage, parameters are explained using stand variables such as number of trees per hectare, basal area, dominant height, etc., as explanatory ... Schnute model has the advantage that it is easy to fit and quick to achieve convergence for any database [6, 29, 30] This is particularly true in preliminary analysis for our database because non-convergence...
- 11
- 301
- 0
Báo cáo khoa học: "Choice of a model for height-growth in maritime pine curves" pps
Ngày tải lên :
08/08/2014, 19:21
... reducing the parametric nonlinearity, but we did not investigate this point in forcing us to think about those aspects of the model for which the data provide good information and those aspects for ... the dual influence of the shape parameter in this case, which partially explains the high e-correlation For this model, a variable shape parameter between curves will also lead to interpretative ... Chapman-Richards (Richards, 1959) variableshape functions Both curves have parameters, which have the following meanings: A asymptote; r= related to relative growth rate; m shape parameter; and...
- 10
- 280
- 0
Báo cáo y học: "Outcome of crisis intervention for borderline personality disorder and post traumatic stress disorder: a model for modification of the mechanism of disorder in complex post traumatic syndromes" ppsx
Ngày tải lên :
08/08/2014, 23:21
... examine for any associations between the demographic variables and the total score of the BPRS, BSI, and Client Observation Scale General linear model (mixed model analysis of variance (ANOVA)) was ... such as when raters were available and did not interfere with the subjects' other commitments All raters had undergone the same training and testing for inter-rater reliability The raters explained ... between and 24 h from the beginning of treatment (that is, from the subject's examination by a psychiatrist and formulation of a treatment plan by the clinical team) Research assistants ('raters'),...
- 12
- 477
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
Ngày tải lên :
09/08/2014, 04:20
... particular individuals in a stand Sap flow data have been used for estimating hourly transpiration and canopy conductances in a range of forest stands [1, 10, 13, 19, 20] The sap flow measurements can ... on each site ’upscaled’ the sap flux values from tree to stand using optically determined leaf area index values (table I), assuming the needles had a semi-cylindrical shape, and calculating ... resisand capacitances are expressed on an all-sided needle area basis The water potential values used in the present paper are corrected for the gravitational gradient The basic equations for each...
- 18
- 406
- 0
Báo cáo y học: "Data from necropsy studies and in vitro tissue studies lead to a model for allometric scaling of basal metabolic rate" pot
Ngày tải lên :
13/08/2014, 23:20
... 399:130-132 Banavar JR, Damuth J, Maritan A, Rinaldo A: Supply-demand balance and metabolic scaling Proc Natl Acad Sci USA 2002, 99:10506-10509 Darveau C -A, Suarez RK, Andrews RD, Hochachka PW: Allometric ... conceptualization has also been used to develop a five-compartment anatomical model (brain, liver, kidney, heart and all other organs) as an explanation for Kleiber's law [28] The anatomical con- Page ... multiple data points for a species were replaced by a single data point calculated as the average value of body weight and the average value of BMR for the species The MLE and 95% CI for the scaling...
- 8
- 356
- 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells
Ngày tải lên :
13/11/2014, 10:46
... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...
- 144
- 306
- 0
Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant
Ngày tải lên :
01/08/2016, 09:29
... experimental data obtained in literature Fu et al [15] analyze without an experimental validation how the performances of an autothermal biomass gasifier are affected by the gasifying air flow and ... Ahmad AA, Zawawi NA, Kasim FH, Inayat A Assessing the gasification performance of biomass: a review on biomass gasification process conditions, optimization and economic evaluation Renew Sustain ... Churchill–Bernstein: ae ¼ Rea ¼ qa ua De insulation la A: 10Þ Pra ¼ Cpa la ka A: 11Þ The evaluation of the radiative heat exchange between the cover of the external thermal insulation of the gasifier and...
- 12
- 221
- 0
Application of house’s model for translation quality assessment in assessing the english version of the vietnam’s law on investment no. 59/2005/qh11
Ngày tải lên :
07/11/2012, 14:36
... Legal Systems Page The schema for analyzing and comparing original and translation texts Page 30 INTRODUCTION Rationale for the study Globalization and integration is an inevitable trend in today’s ... chapter is available in Appendix A Except for Articles 7, and 10, all other articles contain at least two clauses with each clause beginning with a cardinal number and each item within one clause ... same message and/or statement in another language” (1981) Later, in A Textbook of Translation he says translation is “rendering the meaning of a text into another language in the same way that...
- 86
- 896
- 5
Tài liệu Báo cáo khoa học: "A MODEL FOR PREFERENCE" ppt
Ngày tải lên :
22/02/2014, 10:20
... 1977 A Framework for Speech Understanding Ph.D Dissertation, Stanford University, Stanford, California Pereira, Fernando C 1985 A New Characterization of Attachment Preferences In: Dowty, David ... Kartunnen, Lauri and Zwicky, Arnold M., Eds., Natural lanquaqe parsinq Cambridge University Press, Cambridge, England: 307-319 Robinson, Jane J 1982 DIAGRAM: A Grammar for Dialogues Communications ... Norman K 1983 Meta-rules as a Basis for Processing Ill-Formed Input American iournal of computational linquistics 9(3-4): 161-177 Wilks, Yorick 1973 An Artificial Intelligence Approach to Machine...
- 6
- 406
- 0