... It is clear that a program can rank Candidate higher than Candidate simply by comparing ngram matches between each candidate translation and the reference translations Experiments over large collections ... (recall) one of these possible choices, but not all Indeed, recalling all choices leads to a bad translation Here is an example Example 4: Candidate 1: I always invariably perpetually Candidate ... Machine and Human Translations lingual human judgments using a maximum n-gram order of 4, although 3-grams and 5-grams give comparable results 2.2 ranking: H2 (Human-2) is better than H1 (Human1),...
Ngày tải lên: 23/03/2014, 20:20
... paragraph, the equations have the same qualitative shape for any value assigned to the parameters Hence, for the sake of simplicity, it is possible to assign the same values to most of the parameters, ... describe and/or predict the number and approximate location of stable steady states under a wide range of values for the parameters would call the validity of the reconstruction of a particular network ... 24 Acknowledgements We want to thank Massimo de Francesco, Mark Ibberson, Caroline Johnson-Leger, Maria Karmirantzou, Lukasz Salwinski, François Talabot and Francisca Zanoguera for their valuable...
Ngày tải lên: 13/08/2014, 23:20
Method for online measurement of the CHON composition of raw gas from biomass gasifier
... rate and amount of condensables in raw gas To get a measurement of the mass flow rate of raw gas leaving the gasifier, a known flow rate of an inert gas, e.g., helium, is mixed with the gasification ... evolution for biomass gasification: a review Appl Energy 2013;111:129–41 [23] Coda B, Zielke U, Suomalainen M, Knoef HAM, et al Tar measurement standard: a joint effort for the standardization of a method ... gasification agent, to allow correlating the measured CHON mass fractions of raw gas with the unit mass of helium fed to the gasifier In a similar manner, a rapid measurement of the amount of condensables...
Ngày tải lên: 01/08/2016, 09:32
Tài liệu The Cost of a Military Person-Year - A Method for Computing Savings from Force Reductions pptx
... includes average basic pay for each military grade, basic allowance for housing, basic allowance for subsistence, and federal tax advantage accruing to the aforementioned allowances because they are ... SOURCE: OSD Of ce of Program Analysis and Evaluation (PA&E) NOTE: Data are budget estimates, not execution data avoided by this action If a similar calculus can then be performed for an alternative ... The nature of modern warfare and modern casualty treatment options have changed the ratio and cost of deaths and disabilities drastically 12 The Cost of a Military Person-Year have left military...
Ngày tải lên: 17/02/2014, 23:20
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx
... row of the characters before and after "(" Cte") (3) Both the Error-Pattem-Database and String-Database can be mechanically prepared, which reduces the effort required to prepare the databases and ... to speech translation ACI.JF_.ACLWorkshop Spoken Language Translation, pp 24-31, 1997-7 H Tsukada et al., 97 Integration of grammar and statistical language constraints for partial word-sequence ... ~'¢ ' "Hai arigatou gozaimasu Kyoto Kanko Hoteru yoyaku gakari de gozaimasu", ('l'hank you for calling Kyoto Kanko Hotel reservations.) Input String: -¢, "A hai arigatou gozaimasu e Kyoto Kanko...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khoa học: "A Method for Word Sense Disambiguation of Unrestricted Text" potx
... combination since there are many to choose from and many are semantically close For applications such as machine translation, fine grain disambiguation works well but for information extraction and ... sources for word sense disambiguation Computational Linguistics, 18(1):1-30 R Mihalcea and D.I Moldovan 1999 An automatic method for generating sense tagged corpora In Proceedings of AAAI-99, Orlando, ... defined as "any physical damage'(hypernym: health problem) This is a typical example of a mismatch caused by the fine granularity of senses in WordNet which translates into a human judgment that is...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot
... types, for a total of millions of constraints—and these are variables and constraints over a domain of sets, not integers or reals General-purpose set programming software cannot handle such instances ... variants of Bloom filters may in turn prove to be of some value in language modelling 1.1 Notation and definitions A partial order X, consists of a set X and a reflexive, antisymmetric, and transitive ... successor of exactly one other element ULs are special because their set programming constraints always take a particular form: if x is a UL and a successor of y, then the constraints on its set Sx are...
Ngày tải lên: 17/03/2014, 00:20
Báo cáo khoa học: "A Method for Effective and Scalable Mining of Named Entity Transliterations from Large Comparable Corpora" doc
... resources are available only in a handful of languages Finally, it is important to use as little language-specific knowledge as possible in order to make the mining method applicable across a vast majority ... cross-language document similarity model requires a bilingual dictionary in the appropriate language pair Therefore, we generated statistical dictionaries for language pairs (from parallel corpora of ... source language NE with a random nonmatching target language NE No language specific features were used and the same feature set was used in each of the language pairs making MINT language neutral...
Ngày tải lên: 24/03/2014, 03:20
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... Contextual word similarity and estimation from sparse data Computer, Speech and Language, 9:123–152 Keiji Shinzato, Tomohide Shibata, Daisuke Kawahara, Chikara Hashimoto, and Sadao Kurohashi 2008 ... relations are used as context profiles as in Kazama and Torisawa (2008) and Kazama et al (2009) From a large corpus of Japanese Web documents (Shinzato et al., 2008) (100 million Scientific Library ... 0.0721 As for BCb , we assumed that all of the hyperparameters had the same value, i.e., αk = α It is apparent that an excessively large α is not appropriate because it means ignoring observations...
Ngày tải lên: 30/03/2014, 21:20
a novel method for the synthesis of titania nanotubes using
... for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 363 466 0A) After an initial increase-decrease transient, the current reached a steady-state value The anodized samples were properly washed...
Ngày tải lên: 05/05/2014, 15:26
a novel method for the synthesis of cao nanoparticle
... high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, such as of edge and corner ... decomposition applications of Co-Precipitation in the absence and presence nanosized metal oxides such as AP-MgO, AP- of Polyvinylpyrrolidone (PVP) as a capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent ... The average particle size of diffraction angle The average particles size nanoparticles was investigated from line by Debye-Scherrer formula was estimated broadening of the peak at 2θ=0 10° via...
Ngày tải lên: 06/05/2014, 08:55
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis and ... the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The authors ... viability of non-treated days cultured bone demonstrated a central area of decreased marrow survival Macroscopically, all treatment groups, cultured on for days, showed almost no detectable marrow...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... 28.35%) had a relapse of the deformity Patient age at the time of relapse, bilateralism or unilateralism of the relapse foot, relapse foot deformity, treatment offered to relapsed foot, immediate ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx
... Page of 100 points indicating a normal foot This includes a maximum score of 30 points for amount of pain; of 20 points each for level of activity and patient satisfaction; and of 10 points each ... 28.35%) had a relapse of the deformity Patient age at the time of relapse, bilateralism or unilateralism of the relapse foot, relapse foot deformity, treatment offered to relapsed foot, immediate ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... extraction of DNA of the samples and simple incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison between QDs and superparamagnetic nanoparticle-based ... http://www.nanoscalereslett.com/content/6/1/461 Page of Modification and coupling of superparamagnetic nanoparticle Determine of cutoff value and validation of QDs and superparamagnetic nanoparticle-based hybridization 3-Aminopropyl-trimethoxysilane...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx
... Faculty of Liberal Arts, Rajamangala University of Technology Rattanakosin (Rmutr), Bangkok 10100, Thailand 3Centre of Excellence in Mathematics, Che, Si Ayuthaya Road, Bangkok 10400, Thailand ... doi:10.1016/j.na.2007.08.045 Takahashi, S, Takahashi, W: Strong convergence theorems for a generalized equilibrium problem and a nonexpansive mappings in a Hilbert space Nonlinear Anal Ser A Theory Methods ... x∈F(S) where h is a potential function for gf For finding a common element of the set of fixed points of a nonexpansive mapping and the set of solutions of variational inequalities for a ξ-inverse-strongly...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: "Research Article A Method for Visualizing Independent Spatio-Temporal Patterns of Brain Activity" potx
... eigenvalues of the transformed covariance matrices have maximal variance for one class and minimal variance for the other class First, for the two classes (1 and 2), the classlabeled observations are ... Laplacian spatial filter as well as a manageable feature space for the ISTP method 4.1 Common Spatio-Temporal Patterns Prior to performing the ICA, the Common Spatio-Temporal Patterns (CSTPs) can ... several weeks 3.2 Data Collection and Feature Extraction The details of the data collection and analysis are as follows Using BCI2000 software [17], the EEG activity was collected from 64 channels...
Ngày tải lên: 21/06/2014, 19:20
Báo cáo hóa học: " Research Article A Method for Source-Microphone Range Estimation in Reverberant Environments Using Arrays of Unknown Geometry" ppt
... Marsaglia, “Ratios of normal variables and ratios of sums of variables,” Journal of the American Statistical Association, vol 60, no 309, pp 193–204, 1965 [13] EASE, “Enhanced acoustic simulator ... a change of scale, Q0,1,2 has the same distribution as the ratio of two uncorrelated normal random variables of unity variance, N(α, 1)/N(β, 1) The real constants α and β may be calculated as ... microphones and sound source have a significant bearing upon the accuracy or otherwise of source localization algorithms as well as that of the Range-Finder method For this reason, any experimental comparisons...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: " A Method for Assessment of Segmentation Success Considering Uncertainty in the Edge Positions" pptx
... n-Rold´ n, J F Gomez Lopera, C Atae-Allah, J a a Mart´nez-Aroza, and P L Luque-Escamilla, A measure of ı quality for evaluating methods of segmentation and edge detection,” Pattern Recognition, vol ... some kind of uncertainty could appear In this work, real images are used to obtain the ideal segmentation Although the creation of the ideal segmentation of each real image must be manual, and thus, ... the image to provide a measure of the quality of the segmentation process An example of this group of methods called UMA (ultimate measurement accuracy) was proposed in [5], where features of segmented...
Ngày tải lên: 22/06/2014, 23:20
Báo cáo hóa học: " A Method for Single-Stimulus Quality Assessment of Segmented Video" pdf
... irregularly sampled and uncertain data is addressed in a novel way This involves the separation of both data and operator applied to the data in a signal part and a certainty part Missing data in ... sampling ratios smaller than 5% Additionally, NDC is the only method that allows the direct calculation of gradients of irregularly and sparsely sampled data [24] 3.3 Adaptation to local topology As ... limitations (i) Occasional unreliability due to the fact that the averages are calculated in an area further away from the boundary In fact the closest pixel is at a distance L − (M/2) (ii) No adaptation...
Ngày tải lên: 22/06/2014, 23:20