a method based on the solution of an auxiliary equation
Báo cáo hóa học: "Single-photon Transistors Based on the Interaction of an Emitter and Surface Plasmons" docx
... surface plasmon mode of the nanotip and nanowire are excited surface plasmons [22] In the stage of photon storage, the ‘gate’ photon propagating along the nanotip is on resonant with the transition ... can, first, let one photon change the state of an emitter, and then such change will significantly affect the propagation of another one According to this principle a single-photon transistor may ... photon can control the propagation of a single ‘signal’ photon through changing the internal state of an emitter assisted by classic control field This transistor may find many important applications...
- 4
- 326
- 0
1 an envelope detection method based on the first vibration mode of bearing vibration
... range of the first-vibration-mode for a vibration signal In general, an easy and feasible way to designate the resonance frequency is to choose a peak ^ at the frequency f in the range of the first-vibration^ ... transform However, this method theoretically has a limitation that the sampling rate of the vibration signal must be at least six times higher than the resonance frequency Fortunately, the resonance ... investigated and applied in the bearing defect diagnosis A study on the bearing vibrations 2.1 Amplitude modulation of bearing vibration In a bearing system, the carrier signal could be a combination...
- 13
- 511
- 0
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers
... and Social Context, Levels of Context, Levels of Language, Metafunction, Instantiation, Rank and Nominal Group Language and Social Context Systemic Functional Grammar was established as a linguistic ... metaphor of mood The reason why these examples are regarded as metaphorical, lies in the fact that they deviate from the standard, most straightforward realization of a command by means of the imperative ... and affect the fulfillment of the goal of the verbal interaction Verbalization and grammatical metaphor By definition, verbalization refers to the language phenomenon that a non-process is taken...
- 53
- 1,012
- 3
Báo cáo hóa học: " Research Article A Multiuser MIMO Transmit Beamformer Based on the Statistics of the Signal-to-Leakage Ratio" doc
... knowledge of the second-order statistics such as the covariance matrix of the downlink userchannels The motivation behind this assumption is that the knowledge of instantaneous channel information can ... function of the antenna spacing, average direction of arrival of the scattered signal from ith user, and the corresponding angular spread [20] We invite our readers to have a look at [20] and the ... channel Considering that all users can access a given subcarrier and that the lengths of channel impulse responses for all receive-transmit antenna combinations of all users are shorter than the...
- 10
- 317
- 0
Báo cáo hóa học: " Video Waterscrambling: Towards a Video Protection Scheme Based on the Disturbance of Motion Vectors Yann Bodo" pdf
... domain In the second one, the authors embed the mark in the spatial domain The main advantage of the second approach is that it is able to embed more than 250 bits and to withstand stirmark attack ... implementation of these two attacks led to the following conclusions: (i) the first attack generates many block artifacts on the block boundaries These artifacts can be explained by the fact the attacker ... Still image -based techniques Primarily, watermarking algorithms for video were simply an adaptation of still image techniques Langelaar et al [10], Nikolaidis and Pitas [11], and O’Ruanaidh et al...
- 14
- 580
- 0
Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx
... resistant the calculation An example ofto puromycin to estimate the proportion of An example of the calculation to estimate the proportion of cells resistant to puromycin Data from table was plotted ... determined One important assumption made was that the frequency of infection of target cells is random, thus permitting statistical analysis The advantages are that the method is simple and inexpensive ... calibration cultures and the sample, allowing a valid, direct comparison of the growth curves To obtain a more precise estimate, an idealised mathematical formula was used An idealised formula...
- 10
- 278
- 0
Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx
... performed the research and drafted the manuscript ZAMH formulated the study, gave informative suggestions upon the research and refined the manuscript All authors read and approved the final manuscript ... identify candidate PCOS genes is the microarray -based comparison of ovarian tissues (theca cells, follicular granulose cells, total ovarian tissue, and ovarian connective tissue) from PCOS patients ... hormone action [8] Mutation analyses, linkage studies and case-control association studies have been used to assess the roles of candidate genes from these pathways in PCOS [9] CYP1 1A is a steroid...
- 7
- 358
- 0
Báo cáo sinh học: "A simulation study on the accuracy of position and effect estimates of linked QTL and their asymptotic standard deviations using multiple interval mapping in an F2 scheme" ppsx
... Mayer et al Table III Means and empirical standard deviations of additive QTL effect estimates over 100 replicates of simulation models and and means and standard deviations of the estimated asymptotic ... (in cM) of simulation models and and means and standard deviations of the estimated asymptotic standard deviation (R2 : relative QTL variance; a: all replicates (N = 100); s: based on the most ... the evaluation of the accuracy of the estimation is an important issue, their program does not provide any information on the accuracy of the estimates The MImapqtl program of the QTL Cartographer...
- 25
- 327
- 0
An image registration method based on the local and global structures
... range of translations, rotations, and scale changes; the template is translated, rotated, and scaled for each possible translation, rotation, and scale of interest As the number of transformations ... rotation and translation invariant feature by using some other feature points in the same image (Without specification, rotation and translation in this thesis stand for 2D rotation and 2D translation ... satellite data into maps; and medical imaging—comparison of the patient’s image with the digital anatomical atlases, specimen classification 2.1.2 Standard image registration stages Due to the...
- 92
- 474
- 0
LAKE EUTROPHICATION MODEL BASED ON THE IMPACT OF THE ZOOPLANKTON COMMUNITY ON PHYTOPLANKTON SUCCESSION
... Hydrocaryaceae in Pond #3 and Hydrocaryaceae and Lemnaceae in Pond #4 During the pre-observation period, these ponds were rendered stable as regards the lack of inorganic - 76 - Journal of Water and ... other hand, each state variable (box) described in Fig consists many species and growth stages of organisms Therefore, the kinetic parameters of them have a certain ranges of statistical variations ... plankton P P and the calculation results Note that the E&D E&D E calculation results have some bands As E U P mentioned above, the calibrated M Dissolved parameters based on actual observation...
- 8
- 524
- 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the ... mechanical, thermal, and electrical contact between the central parts of the gas diffusion backing and Membrane-Electrode-Assembly (MEA) 2.2 Model equations 2.2.1 Air and fuel gas flow In natural...
- 16
- 727
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not consist of the processing of information or data, since the obtaining of tacit ... practices and tools were used, related to the strategy and core features and surrounding conditions of the firm One of the most important of these was organization of the work into teams Changes ... creation, accumulation and transmission of knowledge F J Forcadell and F Guadamillas Knowledge and Process Management CASE STUDY Figure Irizar chart Figure Organizational success factors in the...
- 10
- 1,063
- 1
Tài liệu A Historical Primer on the Business of Credit Ratings docx
... owners of financia l assets, the institutions (both public and private) that guarantee the assets, and the asset managers that act as agents for the principals or owners An asset manager, for example, ... What the rating agencies to earn their keep? The traditional answer to this question is that the agencies gather and analyze all sorts of pertinent financial and other information, and the n ... U.S railroad corporations The corporate bond market, essentially a railroad bond market in its early decades, can properly be viewed as an American financial innovation that later spread to the...
- 30
- 611
- 1
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... present case we can take πB = A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason why the case DA = DB is special We proved ... independently of each other The only interaction occurs when a B-particle and an A- particle coincide; the latter instantaneously turns into a B-particle [KSb] gave some basic estimates for the growth of the ... z, and (2.6) At any site z at which the particles in σ (2) have type A, the particles also have type A in σ (1) Let A (·, ρ) be the random-walk paths associated to the various particles and...
- 67
- 490
- 0
A Modern Treatise on the Principle of Legality in Criminal Law doc
... during the trial of Vernon in 1505, when a man was exonerated of the offense of trespassing for accompanying a married woman to the local church The defense argument was that the man had accompanied ... project, and especially Dean of the faculty of law and vice chairman Dudi Schwartz for his staunch support on so many important occasions I thank Gabriel Lanyi for his comments and Anke Seyfried of ... scholars identify the criminal law with the sanction,6 but the criminal sanction does not stand alone and must necessarily follow from a valid conditional clause The criminal sanction is a measure...
- 214
- 2,149
- 0
MATHEMATICS REVISED BASED ON THE RECOMMENDATIONS OF THE TEXT BOOK DEVELOPMENT COMMITTEE pptx
... Vectors are said to be collinear or parallel if they have the same line of action or have the lines of action parallel to one another Coplanar vectors: Vectors are said to be coplanar if they are parallel ... Circle − general equation, parametric form, tangent equation, length of the tangent, condition for tangent Equation of chord of contact of tangents from a point, family of circles – concetric circles, ... Engineering and other branches of Applied Mathematics Physical quantities are divided into two categories – scalar quantities and vector quantities Definitions: Scalar : A quantity having only magnitude...
- 100
- 312
- 0
Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf
... thus one candidate for an acceptable translation Because the prepositional phrase is a modifier of the main process (indicated by the role feature and the fact that the main process and the modifier ... relate particular instances of what is to be expressed to the categories of semantic organisation that the grammar's semantics requires These categories, and the relationships among them, constitute ... conceptual information and speech act information Penman has a rich variety of inquiries dealing with such information and so makes available a large set of resources and capabilities for any system...
- 9
- 680
- 1
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA ... GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT Immunoglobulin domain (type ... at a ¨ concentration of lm GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma, Deisenhofen, Germany) was used at a concentration...
- 13
- 487
- 0
What Changes Are Being Made to Social Assistance Benefits: A Community Perspective on the Impact of these Changes. pdf
... response to the changes, and about the process for municipal decisionmaking; discover what provincial and local actions are taking place in response to the changes; have a chance to say what ... assistance than other municipality in the region, with 8.5% of local residents relying on social assistance compared to a provincial average of 6.9% One of every 11 residents relies on social assistance ... Table of Contents I Background on Provincial Budget Cuts to Social Assistance …………… Cap on health and non- health related discretionary benefits.……… Community Start-Up and Maintenance Benefit...
- 18
- 390
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25