a member of pvgas company overview information

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

... have been reported to act as phytotoxins [e.g cerato-platanin of Ceratocystis fimbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and ... culture filtrates of Ceratocystis fimbriata f sp platani, in the cell walls of ascospores, hyphae and conidia of this fungus The authors suggested that cerato-platanin may have a similar role to ... located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f sp Platani FEMS Microbiol Lett 233, 341–346 25 Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala...

Ngày tải lên: 07/03/2014, 12:20

14 494 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

... recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site after incubation ... enables expansin activation, accumulation and catalysis under identical pH conditions and explains how expansins may mediate acid growth of plant cell walls Theoretical pI calculations show that ... strong degradation of the full-length allergen and accumulation of a truncated  15-kDa fragment at about pH 4.5 (Fig 3A) This sharp band lacked the N-terminal peptide, as the N-glycosylated Asn residue...

Ngày tải lên: 08/03/2014, 22:20

10 535 0
the effect of monetary incentive on effort and task performance a study of vietnamese company

the effect of monetary incentive on effort and task performance a study of vietnamese company

... compensation program to award managers and accountants a percentage of the company s accounting profit Proponents of accounting-based bonus plans have demonstrated the common usage of it in many ... indicates many disadvantages for the company In many cases, the researchers show that if bonus is calculated based on accounting earnings; this may induce managers and accountants to manipulate ... motivating managers and accountants in providing the true and fair financial statement and performing other tasks in the company TABLE OF CONTENTS DECLARATION OF ORIGINALITY AND WORD COUNT ACKNOWLEDGEMENT...

Ngày tải lên: 13/03/2014, 14:20

89 442 0
Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf

Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf

... oscillation angle of 1° were collected at each wavelength The exposure time was 0.3 s per frame ˚ Native data were collected to a resolution of 1.4 A A total of 360 frames of data with an oscillation ... coli and cause diarrhea in domestic animals In many respects, the roles of the FaeB and FanB proteins in transcriptional regulation are similar to that of PapB in the regulation of the pap operon ... substitution of Arg61 and Arg81 impair DNA-binding in PapB, indicating that these residues are critical for DNA-binding also in FocB [25] The DNA-recognition domain of RNA polymerase rE-factor, another of...

Ngày tải lên: 15/03/2014, 23:20

14 459 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc

... K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., ... Thermoplasma volcanium Proc Natl Acad Sci USA 97, 14257–14262 49 Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Haikawa, Y., Jin-n., o, K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , ... horikoshii; Pa, P abissi; Ss, S solfataricus; St, S tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex...

Ngày tải lên: 16/03/2014, 16:20

12 506 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

... 2589 R sapE–F 2590 F sapE–R 2590 R mopB–F 3103 F mopB–R 3103 R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC ... processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa A search in the PROSITE database of protein families and domains [12] with MCA2590 revealed two ... immunoblot analyses (B) of proteins obtained during the fractionation of M capsulatus Samples of each step during the fractionation procedure were collected and comparable samples (10 lL of each mL fraction)...

Ngày tải lên: 23/03/2014, 11:20

12 393 0
Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx

Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx

... genomic DNA from the S cerevisiae S288C strain using the oligonucleotides 5¢GGCGAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGCTCTAGACTATTTATGGAA TTTCTTATC-3¢ that introduced SacI and XbaI sites ... Coniferaldehyde Veratraldehyde Anisaldehyde Vanillin Propanal Butanal Pentanal Hexanal Heptanal Octanal 2-Methylpropanal 2-Methylbutanal 3-Methylbutanal Trans-2-nonenal Furfural Acetone 100 90 45 15 79 ... (6% acrylamide) and reductase activity staining of yeast extracts and purified enzymes The gel was incubated with 10 mM pentanal and mM NADPH and activity bands were revealed as indicated in Materials...

Ngày tải lên: 31/03/2014, 08:20

8 379 0
Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc

Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc

... Arlington VA: American Psychiatric Association; 2004 Australian Centre for Posttraumatic Mental Health: Australian Guidelines for the Treatment of Adults with Acute Stress Disorder and Posttraumatic ... factors that were modifiable posttrauma (e.g social bonds and social isolation can be acted on and enhanced after someone has experienced a traumatic event; whereas pre-event trait anxiety cannot), ... immediately after a traumatic event (or the disclosure of a past trauma), how to offer assistance in the short and medium term, and how and when to access professional help for a traumatised...

Ngày tải lên: 11/08/2014, 16:22

15 343 0
the subsidy regulations and vietnam’s position as a member of the wto

the subsidy regulations and vietnam’s position as a member of the wto

... The Law of International Trade in Agriculture, 2003, P160-165 22 The Canada – Dairy, report of the Panel, supra n 19, para 4.310 and Canada – Aircraff, report of the Panel, supra n 36, para 5.27 ... dispute cases, Canada – Dairy and Canada – Aircraft it was considered that the use of the term in Article 1.1 (a) was comprehensive rather than illustrative.22 However, according to Article of the ... Vietnam in its capacity as a Member of the WTO Certain basic research methods will be used in the thesis They are the comparative, logical, analytical and legal research methods: The comparative...

Ngày tải lên: 18/08/2014, 12:35

59 314 0
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

... generally agreed upon, open standards JAVA itself is not an agent-application Yet, the Java Agent Template is available which "provides basic agent functionality packaged as a Java application ... ideas and observations - an essential part of the intellectual capital of a company - will be available for everyone And neatly integrated with authoritative external sources"; Internal Databases: ... databases in real-time is a further possibility The thus retrieved information can be updated automatically as often as necessary; Information Enabled Applications: Hoover offers so-called "information...

Ngày tải lên: 08/10/2012, 15:22

100 811 3
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

... 5D The Marketing Strategy of a multinational join stock company multinational join stock company has a certain advantage: a multinational join stock company has always kept its prices as competitive ... companies such as Toshiba(Japanese), Mitsubishi(Japanese), Trane(American) and Sanyo(Japanese) Medical and technical equipment and machinery, mainly imported from the USA, Italy, Germany and Japan ... a multinational join stock company Secondly, a multinational join stock company size and market share have been small The shortage of capital is main cause of the company s modest size and market...

Ngày tải lên: 27/10/2012, 16:51

25 624 8
ENHANCING THE EFFICIENCY OF THE QUALITY MANAGAMENT SYSTEM BY IMPROVING MANAGEMENT RESPONSIBILITY AND HUMAN RESOURCE MANAGEMENT AT VIET A PLASTIC AND COMPOSITE COMPANY

ENHANCING THE EFFICIENCY OF THE QUALITY MANAGAMENT SYSTEM BY IMPROVING MANAGEMENT RESPONSIBILITY AND HUMAN RESOURCE MANAGEMENT AT VIET A PLASTIC AND COMPOSITE COMPANY

... A plastic and composite company in terms of management responsibility and human resource management Viet A plastic and composite company, a company of designing, manufacturing and trading plastic ... field are known as quality management Quality management includes both quality control and quality assurance, as well as the additional concepts of quality policy, quality planning, and quality ... of quality management can help Viet A plastic and composite company take advantages of the experience of the leading top managers as well as improve efficiency of the quality management system...

Ngày tải lên: 18/04/2013, 17:09

33 934 5
A study of lexical, syntactic and pragmatic features of company slogans in english and vietnamese

A study of lexical, syntactic and pragmatic features of company slogans in english and vietnamese

... foreign and Vietnamese newspapers, magazines In brand names always remain in consumers’ minds addition, the data analysis was based on the qualitative and quantitative methods The samples of company ... syntax as well as pragmatics of company slogans Moreover, it can give learners the way how to understand a slogan and the strategies or technique in writing a company slogan in English and Vietnamese ... (Slogan of Casio) [90] - Analysing the strategies identified from the samples (4.9) Take me away! (Slogan of Calgon Fragrance) [95] - Comparing out the similarities and differences of company Although...

Ngày tải lên: 26/11/2013, 13:23

14 1,6K 9
A study of linguistic devices to attribute source of information in news reports   english vs  vietnamese

A study of linguistic devices to attribute source of information in news reports english vs vietnamese

... attribution and its characteristics in syntax, semantics and pragmatics are still inaccessible to many of us 2 THEORETICAL BACKGROUND 2.2.1 Overview of Appraisal Theory The Appraisal framework is an extension ... extension of the linguistic theories of Halliday and his colleagues The Appraisal framework, an approach to exploring, describing and explaining the way language is used to evaluate, to adopt stances, ... meaning at the level of discourse semantics The framework of appraisal theory accommodates analysis of stance as positioning in relation to values and voices in the text The model of Appraisal includes...

Ngày tải lên: 26/11/2013, 13:24

13 462 0
A study of company names in english and in vietnamese

A study of company names in english and in vietnamese

... company names worldwide In the process of approaching various kinds of company names learners of English find that the syntactic and morphological features of company names are really complicated ... states that culture is a system of material and spiritual values which are created by people and are accumulated through practical activities in the interaction between people and their natural ... phrases and clipping in creating personal names of the Vietnamese companies 4.2 THE CULTURAL FEATURES OF THE ENGLISH AND VIETNAMESE COMPANY NAMES 4.2.1 The Cultural Features of the English Company...

Ngày tải lên: 26/11/2013, 13:26

26 819 0
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt

Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt

... information obtained from the OSCE participating States Albania, Armenia, Austria, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Canada, Croatia, Cyprus, Czech Republic, Denmark, Estonia, ... examination and assessment of the efficiency, the advantages and disadvantages of various international and national content regulation measures – particularly vis-à-vis fundamental rights of ... Italy responded positively to this question 44 (78.6%) states responded negatively and Albania, Azerbaijan, Belarus, Kazakhstan, Kyrgyzstan, Latvia, Lithuania, Norway, and Poland explicitly stated...

Ngày tải lên: 18/02/2014, 00:20

238 2,7K 0
Tài liệu PSEUDO-SECRETS: A Freedom of Information Audit of the U.S. Government’s Policies on Sensitive Unclassified Information doc

Tài liệu PSEUDO-SECRETS: A Freedom of Information Audit of the U.S. Government’s Policies on Sensitive Unclassified Information doc

... Management Agency Transportation Safety Administration National Aeronautics and Space Agency Housing and Urban Development Office of Personnel Management National Reconnaissance Office Department of ... illegal means, it is possible to gather at least 80% of information about the enemy.” At more than 700 gigabytes, the DOD web-based data makes a vast, readily available source of information ... Environmental Protection Agency (EPA) Federal Aviation Administration (FAA) General Services Administration (GSA) Immigration and Customs Enforcement (ICE) * National Aeronautics and Space Admin (NASA)...

Ngày tải lên: 18/02/2014, 05:20

54 463 0
Tài liệu Management Information Systems A Synthesis of Transit Practice ppt

Tài liệu Management Information Systems A Synthesis of Transit Practice ppt

... data • Prevent duplication of hardware/software • Provide maintenance and support for hardware/software • Provide user training Past Practices Organizational Barriers Organizational barriers appear ... reasonably easy to maintain and access A database management system should provide a structured query language (SQL) capability SQL provides an application-level standard method for data exchange ... sophisticated applications in at least one of the four management and operational areas under consideration (i.e., administration, planning and operations, materials management, and advanced technology...

Ngày tải lên: 18/02/2014, 11:20

86 1,2K 0
w