a major target for functional foods
Báo cáo khoa học: The human pyridoxal kinase, a plausible target for ginkgotoxin from Ginkgo biloba docx
Ngày tải lên :
07/03/2014, 10:20
... treatment for (a) and 60 (b) with alkaline phosphase (Merck, Darmstadt, Germany; 100 U) at 37°C, as analyzed by HPLC Influence of ginkgotoxin on human pyridoxal kinase This material is available as part ... PKH leads inter alia to a decreased availability of PLP for GAD, which catalyses the formation of c-aminobutyric acid, the most potent inhibitory neurotransmitter in the mammalian brain Decreased ... membrane-bound phosphatases (Fig 2A) [13,14] Inside the brain a rephosphorylation to PLP takes place, again catalysed by pyridoxal kinase (Fig 2A) [7,14] As a consequence, there is a requirement for...
- 10
- 530
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and...
- 12
- 573
- 0
báo cáo hóa học: " A rehabilitation tool for functional balance using altered gravity and virtual reality" potx
Ngày tải lên :
19/06/2014, 10:20
... Ladouceur M, Barbeau H: A treadmill apparatus and harness support for evaluation and rehabilitation of gait Arch Phys Med Rehabil 1995, 76:772-778 Kamel HK, Iqbal MA, Mogallapu R, Maas D, Hoffmann RG: ... and balance in a wide range of categories of patients The system allows natural mediolateral APAs to occur across a wide range of gravity-like loads, an important balance related stimulus that ... with a removable pin The wheel base of a regular hospital bed has been modified to hold a pneumatic force actuator, a flat friction free surface that supports a back pack frame with air bearings,...
- 7
- 475
- 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx
Ngày tải lên :
21/06/2014, 05:20
... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... data clearly show that farmers lack extensive knowledge about the insect pests and diseases and their natural enemies Weaver ant status and farmers’ opinion of them Most orchards had weaver ants, ... of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly...
- 10
- 551
- 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf
Ngày tải lên :
21/06/2014, 06:20
... South Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Dr Keith Christian and Dr Renkang Peng Date commenced February 2006 ... black ant, Tapinoma melanocephalum, that was abundant on the remaining trees of the plot Baiting of competitive ant species Ant baits (Amdro and Campaign ant bait) brought from Australia were tried ... that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly reduced Seven days later after this baiting, weaver ant...
- 12
- 531
- 1
Card Project Progress Report: Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " MS2 pdf
Ngày tải lên :
21/06/2014, 06:20
... least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly show that farmers ... play a very important part in cashew production Table shows that 8% of cashew orchards are managed by women, 70% are jointly managed by men and women and 22% by men The women have had an average ... holders, having about of orchards with the average tree age being years (for grafted materials) and 12 years (for trees produced from seeds) (Table 3) Cashew nut yield was about 1400 kg/ha in 2005 and...
- 7
- 400
- 0
Project Technical Report:" Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam- MS5 " pdf
Ngày tải lên :
21/06/2014, 06:20
... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... theoretical and practical knowledge 2.6 *: = Very satisfactory; = Satisfactory; = Good; = unsatisfactory; = very unsatisfactory Course name: Natural enemies and their conservation Category* Average ranks ... (2) to make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages and disadvantages...
- 24
- 453
- 0
Project Progress Report:Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS7 " ppt
Ngày tải lên :
21/06/2014, 06:20
... had weaver ants Apart from weaver ants, we also found ghost ants (Tapinoma melanocephalum), small sized crematogaster ants (Crematogaster sp) and an unidentified black ant in this orchard, but ... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... ghost ant baiting, weaver ant abundance was greatly reduced from 65% in early January to below 15% late January As a result, the main insect pest damage was much higher and the yield was much...
- 26
- 491
- 0
Project Progress Report: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - Milestone 10 " pptx
Ngày tải lên :
21/06/2014, 06:20
... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... Telephone: Fax: Email: 61 89466706 61 89466847 keith.christian@cdu.edu.au In Australia: Administrative contact Jenny Carter Name: Research Manager Position: Organisation Charles Darwin University ... the weaver ant technology The results showed that all the TOT trainees (56 in the first year and 56 in the second year) successfully passed their examinations Each of them was awarded a graduation...
- 10
- 302
- 0
Nghiên cứu khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " ppt
Ngày tải lên :
21/06/2014, 06:20
... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... developed A manual “Integrated cashew improvement program using weaver ants as a major component – Manual for ICI program trainers and extension officers in Vietnam” was completed A ICI photo book for ... “Integrated cashew improvement program using weaver ants as a major component - Manual for ICI program trainers and extension officers in Vietnam” Charles Darwin University, Australia and Institute...
- 37
- 394
- 0
Collaboration for Agriculture & Rural Development: " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam - MS3 " ppt
Ngày tải lên :
21/06/2014, 06:20
... program, for the part of the TOT training and for the field data analyses Dr Pham Van Bien and Mr La Pham Lan are in charge of Vietnamese personnel and expenses of the project Mr Lan is also ... South Vietnam Vietnamese Project Team Leader Professor Dr Pham Van Bien Australian Organisation Charles Darwin University Australian Personnel Dr Keith Christian and Dr Renkang Peng Date commenced ... insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration orchards has begun Because heavy rainfall in the...
- 10
- 327
- 1
Báo cáo nghiên cứu khoa học " INTEGRATED PEST MANAGEMENT USING WEAVER ANTS AS A MAJOR COMPONENT FOR CASHEW " doc
Ngày tải lên :
22/06/2014, 12:20
... program using weaver ants as a major component Manual for ICI program trainers and extension officers in Vietnam” As planned, the manual includes up-to-date information about cashew botany, breeding, ... et al (1997) The damage caused by mealy bugs and aphids was higher in the IPM plot than in the farmer’s plot, but the average damage was
- 10
- 460
- 0
Báo cáo y học: " Histone deacetylases — a new target for suppression of cartilage degradation" pdf
Ngày tải lên :
09/08/2014, 06:23
... Yoshida A, Yamana J, Yamamura M, Ninomiya Y, et al.: Histone deacetylase inhibitor suppression of autoantibody-mediated arthritis in mice via regulation of p16INK 4a and p21(WAF1/Cip1) expression Arthritis ... reduced as determined by real-time polymerase chain reaction In contrast, expression of the major cartilage structural molecules aggrecan and type II collagen and a number of other metalloproteinases ... metalloproteinase expression in cartilage and demonstrates that the paradigm of inhibition of histone deacetylation leading to gene silencing is not absolute Cawston and colleagues showed many years ago...
- 2
- 397
- 0
Báo cáo y học: " The RNA interference pathway: a new target for autoimmunity" pot
Ngày tải lên :
09/08/2014, 08:22
... RNAi machinery is that RNAi was initially recognized as an antiviral mechanism in plants and certain invertebrates [14] The evolutionary conservation of RNAi suggests a similar role for RNAi ... Gensler TJ, Anderson P: Death, autoantigen modifications, and tolerance Arthritis Res 2000, 2:101-114 Doyle HA, Mamula MJ: Posttranslational modifications of selfantigens Ann N Y Acad Sci 2005, ... core machinery of the RNA interference pathway FEBS Lett 2005, 579:5822-5829 Satoh M, Langdon JJ, Chou, CH, McCauliffe DP, Treadwell EL, Ogasawara T, Hirakata M, Suwa A, Cohen PL, Eisenberg RA,...
- 3
- 311
- 0
Báo cáo y học: " Is interleukin-1 a good target for therapeutic intervention in intervertebral disc degeneration: lessons from the osteoarthritic experience" pdf
Ngày tải lên :
09/08/2014, 10:21
... intra-articular delivery of anakinra (recombinant methionyl human receptor antagonist (r-met HuIL-1ra)) may have beneficial effects on symptoms and structural modifications in animal models of OA ... pain and disease activity A first randomized controlled trial in patients with knee OA demonstrated a good safety profile for one intra-articular injection of IL-1ra (150 mg, the maximum tolerated ... structural damage process of OA but also plays an important role in pain transmission Results from in vitro studies and animal models of OA support the dominant role of IL-1β early in the disease...
- 2
- 412
- 0
Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx
Ngày tải lên :
09/08/2014, 10:23
... 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3' T7 5'-TAATACGACTCACTATAG-3'...
- 8
- 576
- 0
báo cáo khoa học: " Agrobacterium rhizogenes-mediated transformation of Superroot-derived Lotus corniculatus plants: a valuable tool for functional genomics" pptx
Ngày tải lên :
12/08/2014, 03:20
... 5'-GATGATAGTTACAGAACCGACG-3' (forward), 5'-CATTCGGAATCTCCACGTTAC-3' (reverse).GFP: 5'-GTAAACGGCCACAAG TTCAGCG-3' (forward), 5'-TCGTCCATGCCGAGAGTGA TCC-3' (reverse) ng plasmid DNA was used as template ... primer pairs were used for amplification: 5'-ACACTATTTGGTGCCGTTGG-3' (forward) and 5'CTTCCAACCAGAACCAACCC-3' (reverse) for TaNHX2; 5'-TCTGATACTGTTGTGGAGCCT-3' (forward) and 5' TGGGATCAGATTCACTGCTAG-3' ... Estrada-Navarrete G, Alvarado-Affantranger X, Olivares JE, DiazCamino C, Santana O, Murillo E, Guillen G, Sanchez-Guevara N, Acosta J, Quinto C, et al.: Agrobacterium rhizogenes transformation...
- 14
- 247
- 0
Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf
Ngày tải lên :
12/08/2014, 11:22
... Potential confounders of age, gender, BMI, and tibial plateau area for annual change in cartilage volume were included in multivariate analyses A P value less than 0.05 (two-tailed) was regarded as ... Medial compartment Annual change in cartilage volume Cartilage defects progress vs no change Lateral compartment Annual change in cartilage volume Cartilage defects progress vs no change Annual ... coefficients of variation for the medial and lateral tibial cartilage volume measures were 3.4% and 2.0% respectively [35,36] Annual change in cartilage volume was calculated as follow up cartilage volume...
- 8
- 372
- 0
Báo cáo y học: "Th2 cytokines and asthma Interleukin-9 as a therapeutic target for asthma" ppsx
Ngày tải lên :
12/08/2014, 18:20
... indicating a role for IL-13 as a general enhancing factor on TH2 response Respiratory Research Vol No Zhou et al 31 Daniels SE, Bhattacharrya S, James A, Leaves NI, Young A, Hill MR, Faux JA, Ryan GF, ... R, Arima K, Arinobu Y, Yu B, Kruse S, Enomoto T, Dake Y, Kawai M, Shimazu S, Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa ... mice treated with IL-13 had a greater cellular influx and inflammationrelated gene upregulation at lower IL-13 doses and after fewer intratracheal instillations Although IL-13 instillation caused...
- 5
- 246
- 0
Báo cáo y học: " Innate immunity against HIV: a priority target for HIV prevention research" ppt
Ngày tải lên :
13/08/2014, 01:20
... Likewise strategies for blocking generalised immune activation may also have prophylactic potential, and hold great promise as a novel therapeutic approach The major challenge ahead lies in determining ... Donata Medaglini, Steve Patterson, William Paxton, Guido Poli, Manuel Romaris, Guido Silvestri, Roberto Speck, Greg Towers and Hermann Wagner We also thank Natasaha Polyanskaya and Guido Poli for ... Rerks-Ngarm S, Pitisuttithum P, Nitayaphan S, Kaewkungwal J, Chiu J, Paris R, Premsri N, Namwat C, de Souza M, Adams E, et al: Vaccination with ALVAC and AIDSVAX to prevent HIV-1 infection in Thailand...
- 17
- 558
- 0