a major cause of litigation

Báo cáo y học: " Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait" ppsx

Báo cáo y học: " Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait" ppsx

... Ulaanbaatar and Tov province, Mongolia, intrafamilial spread, and risk factors for infection Epidemiol Infect 2005, 133:1131-1142 Dalwai A, Ahmad S, Pacsa A, Al-Nakib W: Echovirus is an important ...

Ngày tải lên: 12/08/2014, 01:21

6 285 0
Báo cáo y học: "Background: Mood disorders including depression and bipolar disorders are a major cause of morbidity in childhood and adolescence, and hospitalizations for mood disorders are the leading diagnosis for all hospitalizations in general hospit

Báo cáo y học: "Background: Mood disorders including depression and bipolar disorders are a major cause of morbidity in childhood and adolescence, and hospitalizations for mood disorders are the leading diagnosis for all hospitalizations in general hospit

... strengths of this analysis lie in the large database, the probability based sampling, and the standardized methodology of the tri-annual data As with other administrative measures of disease, hospital ... Page of Methods The Kids’ Inpatient Database (KID) is one in a family of databases and software tools developed as part of the Healthcare Cost and Utilization Project (HCUP), a Federal-State-Industry ... recently available at the time [14] The unit of analysis is a hospitalization, and it is possible that an individual patient contributes more than one hospitalization to the database in any given year...

Ngày tải lên: 13/08/2014, 18:22

9 449 0
TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf

TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf

... hospital stay was 111 days DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF ... Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF and is associated with very high mortality ... Gradually in weeks he was able to maintain 90% oxygen saturation (SaO2) at room air Anti-tuberculosis therapy was continued and at 12 weeks he was maintaining oxygen saturation (SaO2) of 94% at...

Ngày tải lên: 06/03/2014, 04:20

7 352 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Arthritis A leading cause of disability in the United States docx

Arthritis A leading cause of disability in the United States docx

... AGE SOURCE: National Academy on an Aging Society analysis of data from the 1992 Health and Retirement Study and the 1993 study of Asset and Health Dynamics Among the Oldest Old A N A G I N G S ... 61 70+ AGE SOURCE: National Academy on an Aging Society analysis of data from the 1992 Health and Retirement Study and the 1993 study of Asset and Health Dynamics Among the Oldest Old s A lower ... conditions later in life The National Academy on an Aging Society is a Washingtonbased nonpartisan policy institute of The Gerontological Society of America The Academy studies the impact of demographic...

Ngày tải lên: 28/03/2014, 19:21

6 528 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc

... wide range of activities of phosphorylase a; (b) that suppression of GSK-3 activity, in the absence of inactiva- tion of phosphorylase, causes a large activation of glycogen synthase but a small ... preparations indicated Statistical analysis was by Student’s paired t test Fig Time course of inactivation of phosphorylase a (A) and activation of glycogen synthase (B) by 10 nM insulin Hepatocytes ... phosphorylase inactivator, we suggest that additional factors may be involved in translocation of glycogen synthase and that phosphorylase a itself may be an important determinant of the subcellular...

Ngày tải lên: 31/03/2014, 01:20

9 381 0
báo cáo hóa học:" Diagnostic challenge: bilateral infected lumbar facet cysts - a rare cause of acute lumbar spinal stenosis and back pain" pptx

báo cáo hóa học:" Diagnostic challenge: bilateral infected lumbar facet cysts - a rare cause of acute lumbar spinal stenosis and back pain" pptx

... this article as: Freedman et al.: Diagnostic challenge: bilateral infected lumbar facet cysts - a rare cause of acute lumbar spinal stenosis and back pain Journal of Orthopaedic Surgery and Research ... 95-100% of patients will have low back pain, as well [1,2,9] Facet sagittal orientation (> 45 degrees) and facet arthrosis are present in over 77% of patients with symptomatic lumbar facet cysts ... outcome Acta Neurochir (Wien) 2006, 148:47-54 10 Fujiwara A, Tamai K, An HS, Lim TH, Yoshida H, Kurihashi A, Saotome K: Orientation and osteoarthritis of the lumbar facet joint Clin Orthop Relat Res...

Ngày tải lên: 20/06/2014, 04:20

5 326 0
Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx

Báo cáo y học: "Small variable segments constitute a major type of diversity of bacterial genomes at the species level" pptx

... Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa ... the alignment Given the abundance of annotated data available for E coli in databases, we selected this species to perform a mapping of the VSs to available annotations such as bacteriophages, ... search of repeats of length >10 bp with a Hamming distance of was carried out A final scan was done in case of repeat detection failure, for exact repeats ≥ bp (this value was chosen based on an...

Ngày tải lên: 09/08/2014, 20:21

15 424 0
Báo cáo y học: "A rare cause of forearm pain: anterior branch of the medial antebrachial cutaneous nerve injury: a case report" pdf

Báo cáo y học: "A rare cause of forearm pain: anterior branch of the medial antebrachial cutaneous nerve injury: a case report" pdf

... was detected which may cause MACN neuropathy As well as NSAI drug treatment, physical therapy of 15 days (TENS, ultrasound, ROM exercises) was applied to the patient The complaint of pain was ... in one of their cases was not isolated, but was assosiated with lesion of the median nerve, and that the reason for a second case with isolated MACN neuropathy was repeated minor trauma [8] In ... MACN which has developed due to repeated minor trauma Case presentation A 37-year-old woman patient who is a homemaker was accepted to our hospital with the complaint of a 10-day pain in her right...

Ngày tải lên: 10/08/2014, 10:20

4 349 0
báo cáo khoa học: "Epidural varicosis as a possible cause of radicular pain: a case report" docx

báo cáo khoa học: "Epidural varicosis as a possible cause of radicular pain: a case report" docx

... embolism was found to be caused by hypoplasia of her inferior vena cava, with a bilateral occlusion of her vena iliaca communis A diagnostic evaluation showed that a collateral pathway with ectatic ... diagnosis of radicular complaints A review of the recent literature and the case of our patient shows that the presence of epidural varicosis, without also being aware of a vascular abnormality, ... spine simulating prolapse of an intervertebral disc A report of six cases Spine 2003, 1:E5-E12 Gümbel U, Pia HW, Vogelsang H: Lumbosacral vascular anomalies: cause of sciatica Acta Neurochir...

Ngày tải lên: 10/08/2014, 22:20

3 279 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Blunt trauma as a suspected cause of delayed constrictive pericarditis: a case report." docx

Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Blunt trauma as a suspected cause of delayed constrictive pericarditis: a case report." docx

... echocardiogram showing dilated intrahepatic vein and inferior vena cava: (a, b) CT axial and coronal views of pericardial and pleural thickening Arrows point to areas of thickened pleura and pericardium ... differential diagnosis of CP The clinical diagnosis of CP relies primarily on appearance of edema and signs of cardiac insufficiency, such as dyspnea, upon physical examination Noninvasive CT scan and ... the diagnosis and management of pericardial diseases Executive summary: The task force on the diagnosis and management of pericardial diseases of the European Society of Cardiology Eur Heart J...

Ngày tải lên: 11/08/2014, 00:22

5 471 0
báo cáo khoa học: " A rare cause of chronic mesenteric ischemia from fibromuscular dysplasia: a case report" potx

báo cáo khoa học: " A rare cause of chronic mesenteric ischemia from fibromuscular dysplasia: a case report" potx

... perinuclear anti-neutrophil cytoplasmic antibodies (P-ANCA), cytoplasmic anti-neutrophil cytoplasmic antibodies (C-ANCA), antisaccharomyces antibody (ASCA), antinuclear antibody (ANA), celiac profile, ... infection, was also negative A pan-CT scan with contrast looking for malignancy of the abdomen, pelvis, chest and head were all negative A transvaginal ultrasound and pelvic examination ruled out an occult ... with significant atherosclerosis of the abdominal arteries causing postprandial abdominal pain out of proportion to physical examination [1] The abdominal pain is exacerbated after meals due to...

Ngày tải lên: 11/08/2014, 02:22

9 230 0
Báo cáo y học: "Linear scleroderma as a rare cause of enophthalmos: a case report" pptx

Báo cáo y học: "Linear scleroderma as a rare cause of enophthalmos: a case report" pptx

... Conclusion Linear scleroderma is an unusual cause of enophthalmos, however the presence of a linear scar on the forehead "en Page of (page number not for citation purposes) Journal of Medical Case Reports ... infiltrates characterize the inflammatory phase The skin appears indurated at this time The collagen bundles become hyalinized, thus replacing subcutaneous fat and muscle, characterize the late ... limbs are the most commonly affected but the fronto-parietal area of the forehead and scalp may also be involved initially The skin is involved first and appears indurated An ivory colored, band-like...

Ngày tải lên: 11/08/2014, 10:23

3 342 0
Báo cáo y học: " Coxiella burnetii as a possible cause of autoimmune liver disease: a case report" pps

Báo cáo y học: " Coxiella burnetii as a possible cause of autoimmune liver disease: a case report" pps

... alanine aminotransferase (ALAT, 120 U/L), gamma-glutamyl transferase (ү-GT, 240 U/L) and bilirubin (27 μmol/L) A test for malaria was negative Lumbar puncture, chest X-ray and abdominal ultrasound ... suggest a causal relationship between PBC and infection, such as case clustering within well-demarcated geographical areas and an increased risk of recurrence after liver transplantation with increasing ... in patients with autoimmune liver disease in order to exclude underlying Coxiella infection Abbreviations AIH, autoimmune hepatitis; ALAT, alanine aminotransferase; AMA, antimitochondrial antibodies;...

Ngày tải lên: 11/08/2014, 14:20

4 340 0
Báo cáo y học: "Primary malignant pericardial mesothelioma - a rare cause of pericardial effusion and consecutive constrictive pericarditis: a case report" pps

Báo cáo y học: "Primary malignant pericardial mesothelioma - a rare cause of pericardial effusion and consecutive constrictive pericarditis: a case report" pps

... tumor of unknown etiology Case presentation A 61-year-old Caucasian woman was admitted to our hospital complaining of exertional dyspnea (NYHA III) and chest pain Transthoracic echocardiography ... mesothelioma Lung Cancer 2008, 60:291-293 Maruyama R, Sakai M, Nakamura T, Suemitsu R, Okamoto T, Wataya H, Nishiyama K, Kamei T, Ichinose Y: Triplet chemotherapy for malignant pericardial mesothelioma: ... challenging and often requires a multimodal imaging approach including echocardiography, MRI, CT and FDG-PET scans [6,7] The majority of reported pericardial tumors are metastatic in nature and...

Ngày tải lên: 11/08/2014, 14:21

4 325 0
Báo cáo y học: " Tracheal agenesis as a rare cause of difficult intubation in a newborn with respiratory distress: a case report" pdf

Báo cáo y học: " Tracheal agenesis as a rare cause of difficult intubation in a newborn with respiratory distress: a case report" pdf

... fistula, esophageal atresia, cardiovascular defects, limb defects, duodenal atresia and renal defects Tracheal agenesis can be a manifestation of several syndromes such as VATER (vertebrae, anus, ... surgical management that allows survival in cases of tracheal agenesis Normally, a newborn with tracheal agenesis presents with immediate respiratory distress and an absent or very weak cry This rare ... imperforated anus A diagnosis of tracheal agenesis was made and the family members were Discussion Figure blind exploration level of a normal larynx that Neck pouch at the revealedcricoid (black arrow)...

Ngày tải lên: 11/08/2014, 17:21

3 399 0
Báo cáo y học: " Pelvic digit as a rare cause of chronic hip pain and functional impairment: a case report and review of the literature" pps

Báo cáo y học: " Pelvic digit as a rare cause of chronic hip pain and functional impairment: a case report and review of the literature" pps

... literature For example, Lame [5] and Granieri and Bacarini [7] described a total of six cases, all consisting of a bony structure of at least two bony elements and at least one (pseudo-) articulation ... skeletal bone It is usually identified via radiography and differentiated from post-traumatic myositis ossificans and heterotopic bone by its corticated appearance in the absence of a traumatic ... al [8] reported a case series where one patient had one phalanx and one pseudoarticulation, and two other cases with three bony segments and two pseudoarticulations A similar configuration was...

Ngày tải lên: 11/08/2014, 17:21

3 289 0
Báo cáo y học: "Celiac disease as a potential cause of idiopathic portal hypertension: a case report" pdf

Báo cáo y học: "Celiac disease as a potential cause of idiopathic portal hypertension: a case report" pdf

... Sama SK, Bhargava S, Nath NG, Talwar JR, Nayak NC, Tandon BN, Wig KL: Noncirrhotic portal fibrosis Am J Med 1971, 51:160-169 Ichimura S, Sasaki R, Takemura Y, Iwata H, Obata H, Okuda H, Imai F: The ... malaise, anorexia, diarrhea, abdominal pain and weight loss He had not been compliant with a GFD in the past year despite our recommendation Abdominal CT scan showed splenomegaly, thickening of ... microsomes (ALKM-1), antimitochondrial antibody (AMA), and anti-liver cytosol antigen antibody (ALC-1), were negative The serum gammaglobulin level was normal A gluten free diet was advised At a month...

Ngày tải lên: 11/08/2014, 20:20

4 270 0
Báo cáo y học: " Gluteal pyomyositis in a non-tropical region as a rare cause of sciatic nerve compression: a case report" pot

Báo cáo y học: " Gluteal pyomyositis in a non-tropical region as a rare cause of sciatic nerve compression: a case report" pot

... acute or due to overuse, giving rise to a sub-clinical intramuscular haematoma; and bacteraemia occurring within a few days of the muscle trauma and presumably seeding the haematoma with organisms ... through a posterior approach and 30 ml of purulent material was drained, followed by a thorough washout of the cavity The patient was treated with parental flucloxacillin for days (1 g four times a ... painful, and a palpable area of warmth and induration over the left gluteal region was now evident Haematological and serological investigation revealed a total leukocyte count of 18.4 (14.0 neutrophils),...

Ngày tải lên: 11/08/2014, 21:22

3 209 0
Báo cáo y học: " Sclerosing epithelioid fibrosarcoma as a rare cause of ascites in a young man: a case report" pps

Báo cáo y học: " Sclerosing epithelioid fibrosarcoma as a rare cause of ascites in a young man: a case report" pps

... progressive abdominal distension and pain On clinical examination, it was found that he had no signs of liver disease or lymphadenopathy, but marked, tense ascites Although he had had a pansystolic ... be a low-grade fibrosarcoma capable of metastases, often many years after initial presentation http://www.jmedicalcasereports.com/content/2/1/248 this tumour, although SEF is able to metastasize ... leiomyosarcoma, malignant peripheral nervesheath tumour, epithelial sarcoma, clear cell sarcoma, synovial sarcoma and epithelioid haemangioendothelioma Written informed consent was obtained from...

Ngày tải lên: 11/08/2014, 21:22

3 270 0
w