a long trip home

... intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation of antitumor ... Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M Gomisin A inhibits tumor promotion by 12-O-tetradecanoylphorbol-13acetate in two-stage carcinogenesis in ... treatment groups was analyzed using a two-way statistical analysis of variance (ANOVA), followed by Dunnett t-test and post-hoc analysis when necessary Results Effect of CKBM treatment on gastric tumor...

Ngày tải lên: 03/11/2012, 09:54

... markets Market performance Differences in market practices Commercial real estate sectors The US real estate market Market performance Commercial real estate sectors The Asia Pacific real estate market ... real estate? Gaining exposure to real estate Real estate derivatives Key benefits and challenges of investing in real estate Global real estate investment The UK and European real estate markets ... Global Asset Management (UK) Ltd nor any of the other data sources quoted will be liable for any consequences arising from the inclusion of inaccurate data Some historic data may no longer be available...

Ngày tải lên: 19/02/2014, 14:20

... #2006T13) and OntoNotes (Hovy et al., 2006) Clearly, as one moves towards a more application- and domaindriven idea of ‘correct’ tokenization, a more transparent, flexible, and adaptable approach to ... other abbreviations, oddly), an extra period is hallucinated, so the abbreviation also has one In contrast, C&J add a period to all final abbreviations, CoreNLP groups the final period with a final abbreviation ... track of character start and end positions as offsets between a string before and after each rule application (i.e all pairs I, O ), and these offsets are eventually traced back to the original...

Ngày tải lên: 19/02/2014, 19:20

... anti-access study with us xxi Glossary AB AMC APOD APOE APS ARCENT ARPAC ARSOUTH ASAT ASW ATACMS AWACS BCT C2 CBRNE CENTCOM CEP CONUS EMP Air Base Air Mobility Command Aerial Point of Debarkation ... • “Anti-Access in a Baltic Scenario,” 2003; “Anti-Access in a SWA Scenario,” 2003; “Anti-Access in a PRC-Taiwan Scenario,” 2003; and “Anti-Access Strategies: A Quantitative Analysis of Military ... facilities OCONUS Ways & means CONUS OCONUS Ways & means Ways & means Ways & means CONUS Ways & means Ways & means Available ways & means will differ for state and nonstate actors Attack U.S facilities/...

Ngày tải lên: 15/03/2014, 20:20

... DNp6 3a forward, 5¢-GGAAAACAATGCCCAGACTC-3¢; DNp6 3a reverse, 5¢-GTGGAATACGTCCAGGTGGC-3¢; GAPDH forward, 5¢-GAAGGTGAAGGTCGGAGTC-3¢; GAPDH reverse, 5¢-GAAGATGGTGATGGGATTTC-3¢ Luciferase reporter assays ... 5¢-ACGTGCACCTCCT GAGAAAA-3¢; p21 forward, 5¢-AAGACCATGTGGAC CTGT-3¢; p21 reverse, 5¢-GGTAGAAATCTGTCATGC TG-3¢; Bax forward, 5¢-TGACATGTTTTCTGACGGCAA C-3¢; Bax reverse, 5¢-GGAGGCTTGAGGAGTCTCACC-3¢; ... (GAPDH) products Primer sequences were as follows: Puma forward, 5¢-ACGACCTCAACGC ACAGTACGAG-3¢; Puma reverse, 5¢-AGGAGTCCGCA TCTCCGTCAGTG-3¢; Noxa forward, 5¢-GAGATGCCTG GGAAGAAGG-3¢; Noxa reverse,...

Ngày tải lên: 16/03/2014, 06:20

... 564 A2 1 Polarization of Electromagnetic Radiation A2 1.1 Introduction A2 1.2 States of Polarization: Monochromatic Radiation A2 1.2.1 Linear polarization A2 1.2.2 Elliptical and circular polarization ... polarization A2 1.2.3 Stokes parameters A2 1.2.4 Stokes parameters for scattered radiation A2 1.3 States of Polarization: Quasi-Monochromatic Radiation A2 1.4 Change of Polarization: Depolarization Ratios, ... to Raman with the remark A scientist painted by a scientist’, Raman answered ‘No, an artist painted by an artist’ A detail of Waterlilies by Claude Monet white lead and lapis-lazuli blue (a) ...

Ngày tải lên: 17/03/2014, 14:46

... contributions made to this paper by Webster Kasongo and David Mwakazanga at the Tropical Diseases Research Centre, Zambia in study coordination and data analysis, respectively Finally, the authors thank ... strains from Sierra Leone,” BMC Microbiology, vol 8, article no 103, 2008 [22] J S Jarallah, A K Elias, M S Al Hajjaj, M S Bukhari, A H M Al Shareef, and S A Al-Shammari, “High rate of rifampicin ... American Journal of Respiratory and Critical Care Medicine, vol 152, no 3, pp 1067–1071, 1995 G Ramachandran, A K H Kumar, C Padmapriyadarsini, et al., “Urine levels of rifampicin & isoniazid in asymptomatic...

Ngày tải lên: 22/03/2014, 18:20

... 8784–8792 Kawana Y, Kawana K, Yoshikawa H, Taketani Y, Yoshiike K & Kanda T (2001) Human papillomavirus type 16 minor capsid protein L2 N-terminal region containing a common neutralization epitope ... in HPV5 attachment and infection, albeit with apparently different requirements regarding sulfation, because N-desulfated and N-acetylated variants of heparin rather than the highly sulfated form ... unknown, although the availability of activated virions with a reduced affinity to heparan sulfate will potentially allow its identification Initial cell surface interactions are predominantly L1-dependent...

Ngày tải lên: 23/03/2014, 04:20

... Performance in Organizations New York: Dorset House Bechara, Antoine; Damasio, Hanna; Tranel, Daniel; & Damasio, Antonio R (1997) “Deciding Advantageously Before Knowing the Advantageous Strategy.” ... What May Lie ahead for Knowledge Management? KM promotes development and application of tacit, explicit, and embedded IC; that is, leveraging personal understanding, organizational action capabilities, ... expertise Ø Increased technological capabilities New KM approaches are made possible by advances in information management and technology and applied AI Examples include groupware for collaborative work,...

Ngày tải lên: 23/03/2014, 23:21

... Adult survival rates of shag Phalacrocorax aristotelis, common guillemot Uria aalge, razorbill Alca torda, puffin Fratercula arctica and kittiwake Rissa tridactyla on the Isle of May 1986–96 Atlantic ... effects may be subtle and may affect other aspects of performance such as foraging, as highlighted by a recent study on gray-headed albatrosses (Thalassarche chrysostoma) by Catry et al (2006), and ... relatively abundant and easily available For each individual, annual mean values of colony breeding success were averaged across the first half of the individual’s time at the colony to give a...

Ngày tải lên: 28/03/2014, 16:20

... COQ1 -a COQ1-b dps1 -a dps1-b Description (5¢- to 3¢) CCGGATCCCATGTTTCAAAGGTCTGGC GCCCCCGGGTTACTTTCTTCTTGTTAGTA TAC CCGGATCCATGTTTCAAAGGTCTGGC CGAATTCTTACTTTCTTCTTGT CAGTGAATTCGAGCTCGGTACCC ATACATACTGAATCATCATCTCCTTC ... obtained from TOYOBO (Osaka, Japan) and New England Biolabs Japan (Tokyo, Japan) Protein markers were obtained from Fermentas Life Sciences (Ontario, Canada) and Oriental Yeast (Tokyo, Japan) Antibodies ... fatty acids Proc Natl Acad Sci USA 93, 7534–7539 Suzuki K, Okada K, Kamiya Y, Zhu X, Tanaka K, Nakagawa T, Kawamukai M & Matsuda H (1997) Analysis of the decaprenyl diphosphate synthase (dps) gene...

Ngày tải lên: 30/03/2014, 04:20

... unchanging place, but has a turbance can set it back to an Prairie and savanna flourish dynamic and resilient stability earlier phase Most landscapes only under certain environare a mosaic of many ... BEYOND—WAY BEYOND—NATURAL GARDENING Some of what you have read so far may soun familiar The past twenty years have seen the arrivi of native plant gardens and landscapes that mimi natural groupings ... juxtapose shapes and foliage patterns to please the eye They can teach methods of massing plants to carry the gaze toward a stunning landscape feature Some will reveal tricks that make a small yard...

Ngày tải lên: 24/04/2014, 13:49

... invaluable comments from Manuel Arrelano, Michael Binder, Carlo Favero, Paul Fisher, Clive Granger, David Hendry, Cheng Hsiao, George Kapetanios, Adrian Pagan, Bahram Pesaran, Til Schuermann, James ... Statistical Association (Chapters and 11) and Journal of Econometrics (Chapter 6) And the project has also been assisted greatly by the contributions of Yoga Affandi, Mutita Akusuwan, Mahid Barakchian, ... Global and National Macroeconometric Modelling This page intentionally left blank Global and National Macroeconometric Modelling: A Long- Run Structural Approach Anthony Garratt Department...

Ngày tải lên: 11/06/2014, 05:36

... certain things as aggressive or, conversely, mainstream Many individuals think taking aspirin and statins on a daily basis is aggressive but taking vitamins is mainstream But the data tell a totally ... death rate from cancer hasn’t changed dramatically in the past fifty years, progress against other diseases has relied on single discoveries that have allowed us to treat or eradicate them Examples ... years now the American Heart Association and the American College of Cardiology have recommended flu vaccines for anyone with heart disease because it’s been shown to prevent fatal heart attacks...

Ngày tải lên: 11/06/2014, 12:01

... measure of self-evaluated change in health status in the past year [19] 3) BSQ- Body Shape Questionnaire – Translated into Portuguese and validated for the Brazilian population A 34item measure ... interests Authors' contributions MCLP: design, data collection, interpretation of data and drafting the manuscript HKMA; WLP, AP, DAC, LT, JC: data collection, analysis and interpretation of data ST, ... Statistical analysis All data were analyzed by means of STATISTICA® version for Windows®, with significance set at p £ 0.05 and expressed as means ± SD Table 1: Body Composition and anthropometric...

Ngày tải lên: 18/06/2014, 18:20

... book! And find activities, games, and more at www.brianpcleary.com THIS PAGE INTENTIONALLY LEFT BLANK Come along with me and learn all about reading! Brian P Cleary’s wacky sentences and Jason ... he works as an illustrator of books and greeting cards Alice M Maday has a master’s degree in early childhood education from Butler University in Indianapolis, Indiana, and a Ph.D in early childhood ... snail trail 10 Can you find three words that sound alike? The frail snail is on the trail steam cream dream 12 Can you find three words that sound alike? The steam came from the cream in a dream...

Ngày tải lên: 19/06/2014, 08:20

... that had calculated lumbar load for the sum of daily patient transfer activities We found higher figures of lumbar load in nursing home staff and at the same time back disorders were significantly ... the lumbar spine than home- based staff Furthermore, staff in nursing homes had more abnormal orthopaedic findings, a higher lumbar load and reduced values for work ability The present data therefore ... staff in home care The median lumbar load for staff in nursing homes was 5.4 kNh, in comparison to 3.5 kNh for home care staff (Figure 1) There was no difference between male and female staff...

Ngày tải lên: 20/06/2014, 00:20

... degeneration and olecranon fracture Elbow degeneration and olecranon fracture Mayo Type IIA fracture of the left olecranon after a fall in a 52-year-old woman (A) Lateral (B) and anteroposterior radiographs ... Mayo Scale (VAS) patient satisfaction score (b) Visual AnaFigure logue Elbow Performance score (MEPS) (a) and Mayo Elbow Performance score (MEPS) (a) and Visual Analogue Scale (VAS) patient satisfaction ... with a goniometer Patient-rated outcomes evaluated with the Mayo Elbow Performance Score (MEPS), Visual Analogue Scale (VAS) subjective pain score (10 = unbearable pain) and VAS patient satisfaction...

Ngày tải lên: 20/06/2014, 01:20

... original palmar tilt could not be achieved in all cases despite maintaining radial length and radial The restoration of palmar tilt requires multiplanar ligamentotaxis or a pin in the dorsal fragment ... Postoperative Radiograph (Anteroposterior and Lateral view) Figure 10 Case Radiograph at year followup Anteroposetrior and Lateral view Page of 10 Raju and Kini Journal of Orthopaedic Surgery and Research ... Assessment-On arrival to the hospital a detailed history was elicited and associated injuries were documented Standardised Anteroposterior and lateral radiographs were taken and after thorough evaluation,...

Ngày tải lên: 20/06/2014, 04:20

... original palmar tilt could not be achieved in all cases despite maintaining radial length and radial The restoration of palmar tilt requires multiplanar ligamentotaxis or a pin in the dorsal fragment ... Postoperative Radiograph (Anteroposterior and Lateral view) Figure 10 Case Radiograph at year followup Anteroposetrior and Lateral view Page of 10 Raju and Kini Journal of Orthopaedic Surgery and Research ... Assessment-On arrival to the hospital a detailed history was elicited and associated injuries were documented Standardised Anteroposterior and lateral radiographs were taken and after thorough evaluation,...

Ngày tải lên: 20/06/2014, 07:20