a link to oxidative stress and hypoxia
Báo cáo y học: "Successful tumour necrosis factor (TNF) blocking therapy suppresses oxidative stress and hypoxiainduced mitochondrial mutagenesis in inflammatory arthritis" pot
Ngày tải lên :
12/08/2014, 17:22
... (forward) and 5’TTGCTGCGTGCTTGATGCTTGT-3’ (reverse); for random mutations: 5’-CCTCAACAGTTAAATCAACAAAACTGC-3’ (forward) and 5’-GCGCTTACTTT GTAGCCTTCA-3’ (reverse) Statistical analysis Data are ... participated in the data analysis and manuscript preparation and final approval of the version to be published JNO, UF and DV participated in the study design and supervised the research DV and ... Remans et al indicated synovial T lymphocytes as the main generators of intracellular free radicals in RA patients [35] We demonstrate a correlation between oxidative stress, inflammation and angiogenesis,...
- 9
- 203
- 0
Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx
Ngày tải lên :
19/02/2014, 06:20
... of ethanol and treatment with disulfiram Alcohol Alcohol 28, 461–468 30 Isse T, Oyama T, Kitagawa K, Matsuno K, Matsumoto A, Yoshida A, Nakayama K, Nakayama K & Kawamoto T (2002) Diminished alcohol ... Roman J, Gimenez A, Lluis JM, Gasso M, Rubio M, Caballeria J, Pares A, Rodes J & Fernandez-Checa JC (2000) Enhanced DNA binding and activation of transcription factors NF-kappa B and AP-1 by acetaldehyde ... (disulfiram), an aldehyde dehydrogenase inhibitor, at a final concentration of lm, ethanol was added to each well to a final concentration of mm, and the cells incubated for an additional hour [18]...
- 11
- 473
- 0
Overcoming Secondary Stress in Medical and Nursing Practice: A Guide to Professional Resilience and Personal Well-Being docx
Ngày tải lên :
06/03/2014, 13:20
... nurses—encourage the unit director and physicians to be aware of and accept nurses’ practical sensibilities and innovative ideas as well as their caring and compassionate nature, all of which will greatly ... Croal, Annemarie Belanger, Helen Sue McNamara, Mary Kate O’Brien, and Nancy Keating My nieces Christine Candio and Chemin Malone and My close friends, who were also classmates of my wife at St ... that consist of all cancer patients, all patients with neurologic diseases, all patients awaiting or having had organ transplantation, and so on The result is to produce a remarkable concentration...
- 214
- 549
- 0
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf
Ngày tải lên :
07/03/2014, 12:20
... Biochem (Tokyo) 134, 25–29 12 Kawakami R, Sakuraba H, Kamohara S, Goda S, Kawarabayasi Y & Ohshima T (2004) Oxidative stress response in an anaerobic hyperthermophilic archaeon: presence of a functional ... & Garrett RA (2005) Divergent transcriptional and translational signals in Archaea Environ Microbiol 7, 47–54 17 Bell SD (2005) Archaeal transcriptional regulation – variation on a bacterial ... dehydrogenase (150 kDa), BSA (65.4 kDa), ovalbumin (48.9 kDa), chymotrypsinogen (22.8 kDa) and the RNAse A (15.6 kDa) were used as molecular weight standards Analytical methods for protein characterization...
- 11
- 565
- 0
Báo cáo sinh học: "Metabolic reconfiguration is a regulated response to oxidative stress" pdf
Ngày tải lên :
06/08/2014, 18:21
... generation via G6PDH and 6PGDH is also increased has so far been lacking Ralser et al [3] used a quantitative metabolomic analysis (using liquid chromatography and tandem mass spectrometry) to ... It reacts rapidly and spontaneously with glutathione to cause oxidative stress This finding was extended [3] to show a remarkable correlation between TPI expression levels and oxidant tolerance ... What is clear is that mutations inactivating these pathways can have a detrimental effect on normal lifespan in both yeast and C elegans The work of Krobitsch and colleagues [3] adds to the growing...
- 4
- 337
- 0
Báo cáo khoa học: " Induction of oxidative stress and lipid peroxidation in rats chronically exposed to cypermethrin through dermal application" pps
Ngày tải lên :
07/08/2014, 23:22
... significant changes in GST activity was seen up to 30 days, but thereafter, a significant increase was noticed up to 120 days There was significant decrease in the GSH after 30 days and similar pattern ... 258 Rajinder Raina et al Table Effects of chronic dermal application of cypermethrin on enzymes, blood glutathione and lipid peroxidation in Wistar rats Days after dermal application Parameters ... free radicals [2] However, an increase in catalase activity enhances the scavenging ability of erythrocytes to handle the hydrogen peroxide to molecular oxygen and water [11,29] GSH-Pxs catalyze...
- 3
- 428
- 0
Báo cáo lâm nghiệp: "Response to an ozone gradient of growth and enzymes implicated in tolerance to oxidative stress in Acer saccharum (Marsh.) seedlings" pot
Ngày tải lên :
08/08/2014, 00:22
... However, Manderscheid et al [34] measured a decrease in glycolate oxidase activity (a peroxisomal enzyme of the photorespiratory pathway) in Pinus taeda needles exposed to air pollution As a shade tolerant, ... percentage of symptomatic leaves per seedling We considered that a leaf was symptomatic if at least 2% of his area was injured 2.3 Enzymatic analysis 2.3.1 In vivo nitrate reductase assay At the ... was reported as diHLLL at each concentration of the O3 gradient and at each harvest date We then completed a series of regression analyses using O3 as an independent variable and diHLLL as a...
- 11
- 392
- 0
Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" potx
Ngày tải lên :
12/08/2014, 15:21
... apoptosis in primary human small airway epithelial cells (SAEC) Primary human small airway epithelial cells (SAEC) were treated with media alone (control) and various concentrations of CSE; a) ... Live; A = Apoptosis; N = Necrosis References Kode A, Yang SR, Rahman I: Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial ... apoptotic (grey bars) and necrotic/late apoptotic (black bars) determined by counting as described in Materials and Methods Results are mean of experiments ± SEM *p < 0.05, and §p < 0.001 compared...
- 3
- 307
- 0
Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" pps
Ngày tải lên :
12/08/2014, 16:20
... quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues Anal Biochem 1969, 27:502-522 Rahman I, Antonicelli F, MacNee ... Oxidant and antioxidant balance in the airways and airway diseases Eur J Pharmacol 2006, 533:222-239 Marwick JA, Kirkham PA, Stevenson CS, Danahay H, Giddings J, Butler K, Donaldson K, MacNee ... cytotoxicity, oxidative stress as well as pro-inflammatory cytokine release in a variety of alveolar epithelial cells (A5 49, H1299, H441, MLE-15 and L2), and compared the effect with primary human SAEC...
- 20
- 478
- 0
Hypersensitivity to cell death under glucose starvation involves oxidative stress and AMPK instability
Ngày tải lên :
22/10/2015, 21:19
... such as starvation Autophagy is divided into three categories: macroautophagy (referred as autophagy hereafter, the major type of autophagy), microautophagy and chaperone-mediated autophagy (CMA) ... mitochondria are 12 particularly susceptible to oxidative damage Therefore, clearance and recycling of damaged mitochondria as well as generation of new mitochondrial is important to maintain cellular ... 5-amino-4-imidazolecarboxamide ribonucleoside AID auto-inhibitory domain AMP adenosine monophosphate AMPK AMP-activated protein kinase Apaf-1 apoptosis protease-activating factor-1 ATCC American Type Culture...
- 114
- 261
- 0
Tài liệu OXIDATIVE STRESS AND DISEASES pptx
Ngày tải lên :
12/02/2014, 16:20
... Functions 87 Ana Bertha Zavalza Gómez, Mar a Cristina Islas Carbajal and Ana Rosa Rincón Sánchez Chapter Role of Oxidized Lipids in Atherosclerosis 119 Mahdi Garelnabi, Srikanth Kakumanu and Dmitry ... Nemes-Nagy Enikő, V Balogh-Sămărghiţan, Elena Cristina Crăciun, R Morar, Dana Liana Pusta, Fazakas Zita, Szőcs-Molnár Terézia, Dunca Iulia, Sánta Dóra and Minodora Dobreanu Chapter 13 Diabetes, Oxidative ... Meedeniya Chapter 18 The Relationship Between Thyroid States, Oxidative Stress and Cellular Damage 413 Cano-Europa, Blas-Valdivia Vanessa, Franco-Colin Margarita and Ortiz-Butron Rocio Chapter 19 Oxidative...
- 624
- 1.9K
- 0
Tài liệu AIR UALITY INDEX: A Guide to Air Quality and Your Health docx
Ngày tải lên :
17/02/2014, 22:20
... area • AQI in the media Many local media—television, radio, and newspapers and some national media (such as USA Today, The Weather Channel, and CNN) provide daily air quality reports, often as ... detailed state and local air quality Web sites AIRNow’s reports are displayed as maps you can use to quickly determine if the air quality is unhealthy near you Example of a national AQI map available ... everyone as AQI values increase What the AQI values mean? The purpose of the AQI is to help you understand what local air quality means to your health To make it easier to understand, the AQI is...
- 12
- 518
- 0
Tài liệu Essential Skills for the Agile Developer: A Guide to Better Programming and Design pptx
Ngày tải lên :
18/02/2014, 15:20
... skills work together to make software that is readable, scalable, maintainable, and elegant In addition to these individual authors and thought leaders, we also want to acknowledge the thousands of ... you are in a shipwreck and all the boats are gone, a piano top buoyant enough to keep you afloat that comes along makes a fortuitous life preserver But this is not to say that the best way to ... MobileSpear and subsequently XPand Software, which does agile coaching, software education, and agile projects in Israel and Europe Amir brings his expertise to Net Objectives as a coach and trainer...
- 262
- 1.5K
- 1
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf
Ngày tải lên :
18/02/2014, 16:20
... peroxisome proliferator-activated receptor-alpha (PPARa) and peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC-1), pivotal nuclear regulators of numerous fatty acid metabolic genes ... ability of mitochondria to withstand oxidative stress, mm ADP was added after state respiration, and the chamber was closed and sealed for a 20 period As a result, oxygen in the closed chamber would ... used to convert ADP to ATP, and an anaerobic condition established After 20 of oxygen lack, the chamber was reoxygenated for min, and the percentage recovery of state respiration was calculated as...
- 7
- 582
- 0
Ambient particulate air pollution induces oxidative stress and alterations of mitochondria and gene expression in brown and white adipose tissues ppt
Ngày tải lên :
06/03/2014, 19:20
... Pgc- 1a GAAAGGGCCAAACAGAGAGA GTAAATCACACGGCGCTCTT Dio2 AAGGCTGCCGAATGTCAACGAATG TGCTGGTTCAGACTCACCTTGGAA Elovl3 GCCTCTCATCCTCTGGTCCT TGCCATAAACTTCCACATCCT b-actin TGTGATGGTGGGAATGGGTCAGAA TGTGGTGCCAGATCTTCTCCATGT ... Hoxc9 GCAGCAAGCACAAAGAGGAGAAG GCGTCTGGTACTTGGTGTAGGG Igfbp3 GCAGCCTAAGCACCTACCTC TCCTCCTCGGACTCACTGAT Dpt CTGCCGCTATAGCAAGAGGT TGGCTTGGGTACTCTGTTGTC Ucp1 GGCCTCTACGACTCAGTCCA TAAGCCGGCTGAGATCTTGT ... animals (rats or mice); and (3) biomedical laboratory for laboratory rodent anesthesia, surgery and necropsy, and sample storage AirCARE is certified by the Association for Assessment and Accreditation...
- 14
- 466
- 0
Báo cáo khoa học: Expression of CYP2E1 increases oxidative stress and induces apoptosis of cardiomyocytes in transgenic mice pdf
Ngày tải lên :
22/03/2014, 16:20
... 5¢-CCAAGTTGGCAAAGCGCT-3¢ and 5¢-AAAAGAC CAAAGGCCAGCC-3¢ The expression of the target gene was analyzed by western blot analysis using antibodies to CYP2E1 Polyclonal rabbit anti-CYP2E1 was obtained ... at the tip of the mitral valve apparatus with a 30 MHz transducer (Vevo770; VisualSonics, Toronto, Canada) [22] Histological analysis Separation of cytosolic and mitochondrial fractions Myocardial ... oxidative- nitrosative stress and downstream pathways in various forms of cardiomyopathy and heart failure Curr Vasc Pharmacol 3, 221–229 33 Narula J, Pandey P, Arbustini E, Haider N, Narula N,...
- 9
- 404
- 0
Báo cáo khoa học: Effect of oxidative stress and involvement of poly(ADP-ribose) polymerase (PARP) in Dictyostelium discoideum development doc
Ngày tải lên :
23/03/2014, 07:20
... 20 Oxidative stress induces PARP activation PARP activity in D discoideum was assayed at various time points (5, 10, 20 and 60 and h) after HA stress PARP activity was increased initially, and ... h and then allowing them to develop As can be seen from Table and Fig 3A, development was delayed in a dose-dependent manner at the loose aggregation stage by h and 12 h at LD15 and LD50 of HA, ... exposed to oxidative stress (2.5 mm and mm HA) with PARP inhibition and allowed to develop, the spores showed faster germination (32 h and 60 h) as compared to cells exposed to oxidative stress alone...
- 8
- 363
- 0
A Guide to Clinical Management and Public Health Response for Hand, Foot and Mouth Disease (HFMD) doc
Ngày tải lên :
28/03/2014, 09:20
... progression to ANS, and subsequently to devastating pulmonary oedema Retrospective analysis of IVIG-treated cases in Taiwan (China) and Sarawak, Malaysia, seen during earlier outbreaks, appear to demonstrate ... A Guide to Clinical Management and Public Health Response for Hand, Foot and Mouth Disease (HFMD) WHO Library Cataloguing in Publication Data A Guide to clinical management and public health ... community and the environment (2) The directors and all staff of diagnostic laboratories should be familiar with international and local biosafety requirements, including safe handling and transportation...
- 71
- 774
- 0
TheCortisol Connection Diet THE BREAKTHROUGH PROGRAM TO CONTROL STRESS AND LOSE WEIGHT doc
Ngày tải lên :
29/03/2014, 04:20
... highest balance factor, applesauce is moderate, and apple juice is low x All whole fruits and vegetables have a high balance factor, and thus can be used to “balance” a food that has a lower balance ... DIET a low-balance-factor food (a refined-grain bagel) balances the meal into one with a “moderate” balancefactor profile and it is these “moderate” balance-factor meals that will make up the majority ... daily dosage Magnolia bark Controls cortisol and has general effects as an antianxiety and antistress agent Too much could cause sedation and drowsiness 200–800 mg Beta-sitosterol Balances ratio...
- 148
- 500
- 0