a light aspiration device for it in vivo soft tissue characterization

Báo cáo sinh học: "A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma" ppsx

Báo cáo sinh học: "A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma" ppsx

... Kossila M, Puranen M, Hurskainen H, Tyynela K, Turunen M, Vanninen R, Lehtolainen P, Paljarvi L, Johansson R, Vapalahti M, Yla-Herttuala S: Thymidine kinase gene therapy for human malignant glioma, ... within this area were calculated after background subtraction Final values are reported as the mean of the integrated or maximum counts obtained from all mice within one group The CCD camera in ... U87 glioma cells were transferred to a black microtiter plate in order to minimize light scattering, and MTT assay was performed in quadruplicates as described above On day after addition of...

Ngày tải lên: 14/08/2014, 19:22

13 388 0
Tài liệu Báo cáo khoa học: "A Finite-Slate Parser for Use in Speech Recognition" pdf

Tài liệu Báo cáo khoa học: "A Finite-Slate Parser for Use in Speech Recognition" pdf

... below, indicating the this way standard chart parsing techniques can be adopted to process starting point and ending point of each phrase in the input string allophonic and phonotactic constraints, ... P,ccall that a chart parser takes as input a sentence and a context-free Alternatively, the input sentence can be decomposed into [~'t][slzl In grammar and produces as output a chart like that ... a number of other linguistic constraints mentioned above: voicing and place assimilation, aspiration, flapping etc In short, these mamces are sparse because allophonic and phonotactic constraints...

Ngày tải lên: 21/02/2014, 20:20

7 420 0
Báo cáo khoa học: A pre-docking role for microtubules in insulin-stimulated glucose transporter 4 translocation ppt

Báo cáo khoa học: A pre-docking role for microtubules in insulin-stimulated glucose transporter 4 translocation ppt

... Stockli J, van Dam EM, Winata S, Wasinger V, Simpson F, Graham M, Junutula JR, Guilhaus M et al (2005) Characterization of the role of the Rab GTPase-activating protein AS160 in insulinregulated GLUT4 ... kinase substrates Akt phosphorylates a novel adipocyte protein with a Rab GTPase-activating protein (GAP) domain J Biol Chem 277, 22115–22118 Miinea CP, Sano H, Kane S, Sano E, Fukuda M, Peranen ... 17820–17829 Martin SS, Haruta T, Morris AJ, Klippel A, Williams LT & Olefsky JM (1996) Activated phosphatidylinositol 3-kinase is sufficient to mediate actin rearrangement and GLUT4 translocation in 3T3-L1...

Ngày tải lên: 16/03/2014, 06:20

8 420 0
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG ... 2a+ 2b+ 2– 3+wt 3+YIRN 3– TAATACGACTCACTATAGGGAGACCACAACGGTTTCC GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG GACTGCAaCCCCAAAtCGGACAG CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC ... the sPLA2 toxins and their binding affinity for CaM For example, the substantial increase in the binding affinity for CaM observed by introducing the YIRN cluster into DPLA2 was not accompanied...

Ngày tải lên: 17/03/2014, 03:20

8 401 0
– THE GRE VERBAL SECTION – 4. Once you understand a question, try to answer it in your own potx

– THE GRE VERBAL SECTION – 4. Once you understand a question, try to answer it in your own potx

... about a parish d by comparing it to thunder in a mountain e by invoking an image of a circle The passage implies that laughter is always contained within a specific group because a a larger audience ... beneficial a Palatial means like a palace Chintzy means cheap and inelegant c Omniscient means all-knowing (omni means all) To be ignorant is to know little or nothing d To capitulate is to give in ... scimitar is a type of saber A revolver is a type of gun 16 c A cineaste loves film the way a gastronome loves food 17 a A lap is a unit of measurement for a pool A light- year is a unit of measurement...

Ngày tải lên: 18/06/2014, 17:20

25 727 0
báo cáo hóa học:" Accuracy of biplane x-ray imaging combined with model-based tracking for measuring in-vivo patellofemoral joint motion" doc

báo cáo hóa học:" Accuracy of biplane x-ray imaging combined with model-based tracking for measuring in-vivo patellofemoral joint motion" doc

... collection and analysis, and drafted the manuscript SKK participated in the data collection and analysis ST participated in study design and data analysis RZ developed the data analysis software All authors ... studies have also provided helpful information about patellar tracking, static analyses can not quantify PF joint function during dynamic activities, 2D analyses are incapable of capturing the ... dynamic CT imaging [34] and single-plane fluoroscopic imaging combined with shape matching [35] Dynamic CT imaging has limitations similar to those associated with dynamic MRI The singleplane...

Ngày tải lên: 20/06/2014, 01:20

8 401 0
Báo cáo khoa học: "A new experimental device for rapid measurement of the trunk equivalent modulus of elasticity on standing trees" potx

Báo cáo khoa học: "A new experimental device for rapid measurement of the trunk equivalent modulus of elasticity on standing trees" potx

... Measurement incertitude: Being given that the data involved in MOE calculation for metallic beams are at least 99% accurate, most of the incertitude that we observed was linked to the measurement ... diameter decreases (e.g.: 2% incertitude for a diameter of 100 mm) In conclusion, the device should routinely allow MOE determinations of standing tree with an accuracy reaching at least 95% as ... between-clone variation Analysis of variance of MOE measurements performed on standing trees Analysis of variance allows to pinpoint the eventual effect of different factors on a selected variable As in...

Ngày tải lên: 08/08/2014, 14:22

9 257 0
Báo cáo khoa học: " A new resorbable device for ligation of blood vessels - A pilot study" pps

Báo cáo khoa học: " A new resorbable device for ligation of blood vessels - A pilot study" pps

... the Animal Laboratory at Clinical Physiology, Department of Medical Sciences, Uppsala University, Uppsala, Sweden for invaluable assistance and access to the laboratory We also thank Lena Holm at ... on glass and stained with hematoxylin and eosin (HE) Test of haemostasis and tissue grip of renal arteries in six pigs The abdomen was opened midway along the linea alba and both renal arteries ... Tensile testing Typical load versus strain curves for the devices at a rate of deformation of 40 mm/min Höglund et al Acta Veterinaria Scandinavica 2011, 53:47 http://www.actavetscand.com/content/53/1/47...

Ngày tải lên: 12/08/2014, 18:22

7 307 0
Báo cáo y học: "Novel rapid infusion device for patients in emergency situations" pptx

Báo cáo y học: "Novel rapid infusion device for patients in emergency situations" pptx

... or paramedics can insert Therefore, it has a potential application for use in ambulances, in the fields, Kapoor and Singh Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... doi:10.1186/1757-7241-19-35 Cite this article as: Kapoor and Singh: Novel rapid infusion device for patients in emergency situations Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2011 19:35 • Inclusion ... Page of in emergency rooms, military applications and camp surgeries in disasters We are routinely using this device successfully in our institution in ambulances and ER settings for immediate...

Ngày tải lên: 13/08/2014, 23:20

3 241 0
Báo cáo sinh học: " A trial of somatic gene targeting in vivo with an adenovirus vector" pdf

Báo cáo sinh học: " A trial of somatic gene targeting in vivo with an adenovirus vector" pdf

... generated with the primer pair LZT-U (5'-CGAAGAGGCCCGCAC-3') and LZT-MA (5'-TAATGGGCTAGGTTACGTTGGTGTAG-3'), and the primer pair LZT-MS (5'-TAACCTAGCCCATTACGGTCAATCC-3') and LZT-D (5'-GGCAACATGGAAATCGC-3') ... coordinated the experimental design All authors read and approved the final manuscript 12 13 14 15 Additional material 16 Additional file Bacterial strains, plasmids, bacteriophage strains and ... and its in vitro packaging allowed the recovery of the lambda genome in viable bacteriophage particles A lacZ-negative mutant bacteriophage was selected as a plaque-former in an Escherichia coli...

Ngày tải lên: 14/08/2014, 19:22

11 323 0
Vector sum phase shifter using a quadrature magic t for application in polarization control

Vector sum phase shifter using a quadrature magic t for application in polarization control

... horizontally An antenna capable of transmitting one polarization is called singlepolarized antenna while the antenna capable of transmitting in two orthogonal polarizations and their combinations ... linear polarization antenna can also be converted into a circular polarized antenna by exciting them with a 90° phase difference, or a slant polarized antenna by exciting them in phase (slant ... 16 It consists of a broadband power divider, two variable gain amplifiers (VGAs) and a Quadrature Magic-T circuit For part A, the input signal is divided into two signals, equal in amplitude and...

Ngày tải lên: 30/09/2015, 10:11

144 238 0
báo cáo khoa học: "Prognostic significance of STAT3 and phosphorylated STAT3 in human soft tissue tumors - a clinicopathological analysis" ppt

báo cáo khoa học: "Prognostic significance of STAT3 and phosphorylated STAT3 in human soft tissue tumors - a clinicopathological analysis" ppt

... Location Additional material Additional file 1: Table S1 Clinicopathologic characteristics and expression of STAT3 and pSTAT3 in soft tissue tumors Author details Integrated Cancer Research, Rajiv ... Rajiv Gandhi Centre for Biotechnology, Kerala, India 2District Public Health Laboratory, Alappuzha, Kerala, India Department of Pathology, Kottayam Medical College, Kottayam, Kerala, India Plane ... various soft tissue tumors and to associate it with its clinicopathological characteristics Our data suggests that STAT3 may be a key regulatory molecule in the malignant potential of soft tissue...

Ngày tải lên: 10/08/2014, 10:21

9 434 0
Development of three dimensional fibrous structures via electrospinning for applications in scaffold based tissue engineering

Development of three dimensional fibrous structures via electrospinning for applications in scaffold based tissue engineering

... such as PECAM-1, ICAM-1 and VCAM-1 indicating a more favorable surface for EC to grow and maintain function compared to bare PCL [72] Incorporating nanoceramic fillers of CaCO3 and HAp into electrospun ... on a larger scale with tunable properties Collagen, fibrin, chitosan and hyaluronan are some examples of naturally-derived materials that have been investigated as potential tissue engineering ... observed that the addition of collagen into the structure changed the enthalpy for melting indicating a change in crystallinity Bar is 50 m in A- D; m in E-H 27 Figure Cellular attachment and...

Ngày tải lên: 14/09/2015, 08:24

180 227 0
báo cáo hóa học:" Unilateral or bilateral V-Y fasciocutaneous flaps for the coverage of soft tissue defects following total knee arthroplasty" ppt

báo cáo hóa học:" Unilateral or bilateral V-Y fasciocutaneous flaps for the coverage of soft tissue defects following total knee arthroplasty" ppt

... as it may affect the final range of knee motion Regarding the rehabilitation programme, it is inevitable that if soft tissue necrosis appears after TKA the rehabilitation of the patient is delayed ... skin or fasciocutaneous flaps are inadequate in terms of designing and arc of rotation, the advancement of the V-Y flaps in an horizontal manner parallels the relaxed tension lines leaving a ... the fascia bilateral V-Y flaps without any tension at the central suturing line A V-Y flap is an advancement flap that leaves the tissue to slide toward the defect for a distance almost equal to...

Ngày tải lên: 20/06/2014, 04:20

5 488 0
báo cáo hóa học:" Unilateral or bilateral V-Y fasciocutaneous flaps for the coverage of soft tissue defects following total knee arthroplasty" pot

báo cáo hóa học:" Unilateral or bilateral V-Y fasciocutaneous flaps for the coverage of soft tissue defects following total knee arthroplasty" pot

... as it may affect the final range of knee motion Regarding the rehabilitation programme, it is inevitable that if soft tissue necrosis appears after TKA the rehabilitation of the patient is delayed ... skin or fasciocutaneous flaps are inadequate in terms of designing and arc of rotation, the advancement of the V-Y flaps in an horizontal manner parallels the relaxed tension lines leaving a ... the fascia bilateral V-Y flaps without any tension at the central suturing line A V-Y flap is an advancement flap that leaves the tissue to slide toward the defect for a distance almost equal to...

Ngày tải lên: 20/06/2014, 07:20

5 414 0
báo cáo khoa học: "Thick calcification from a GIST of the stomach penetrating into pericolic soft tissue - report of a case" pptx

báo cáo khoa học: "Thick calcification from a GIST of the stomach penetrating into pericolic soft tissue - report of a case" pptx

... the literature research BA and PC performed the histological studies PS and PD performed the data and statistical analysis PS prepared the manuscript All authors read and approved the final manuscript ... GIST, GANT, and now GIPACT) Implications of c-kit in genesis, and yet another of many emerging roles of the interstitial cell of Cajal in the pathogenesis of gastrointestinal disease Adv Anat Pathol ... statistics or ChiSquare Histopathological re-examination of surgical specimens was carried out by Consultant Histopathologists (PC/BA) using standard hematoxylin and eosin staining as well as...

Ngày tải lên: 09/08/2014, 01:24

4 297 0
Báo cáo y học: "Local recurrence and assessment of sentinel lymph node biopsy in deep soft tissue leiomyosarcoma of the extremities" pdf

Báo cáo y học: "Local recurrence and assessment of sentinel lymph node biopsy in deep soft tissue leiomyosarcoma of the extremities" pdf

... cases is followed by a formal lymph node dissection A number of soft tissue sarcomas, such as rhabdomyosarcoma, clear cell sarcoma and synovial sarcoma, have also been shown to have a propensity ... problems) associated with undertaking SLNB Recent work at our institution has shown that soft tissue sarcomas with a high propensity to metastasise to lymph nodes contain intratumoural lymphatics ... tumours are shown in Table In all cases, local excision of the tumours was performed aiming for Page of complete clearance with as wide a margin as possible 21 of the patients (78%) received adjuvant...

Ngày tải lên: 13/08/2014, 15:21

5 256 0
A STUDY ON EFFECTIVENESS OF APPLICATION INFORMATION TECHNOLOGY TOOLS IN TEACHING ENGLISH FOR IT VOCABULARY FOR SECOND YEAR STUDENTS AT VIETNAM KOREA INDUSTRIAL TECHNOLOGY COLLEGE

A STUDY ON EFFECTIVENESS OF APPLICATION INFORMATION TECHNOLOGY TOOLS IN TEACHING ENGLISH FOR IT VOCABULARY FOR SECOND YEAR STUDENTS AT VIETNAM KOREA INDUSTRIAL TECHNOLOGY COLLEGE

... They are confused in choosing what to since using the Web in teaching has many advantages but also some disadvantages There are many advantages of the Web, for instance, one has access to a Web ... work At issue within SLVA has been the relative importance and efficacy of implicit, explicit and incidental learning mechanisms in the acquisition of L2 vocabulary Recently, incidental vocabulary ... Computer-Assisted Language Learning (CALL) is defined as ‘the search for and study of applications of the computer in language teaching and learning’ Among the concerns often raised in the domain of CALL is...

Ngày tải lên: 07/09/2013, 13:01

42 1K 0
Báo cáo khoa học: A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis doc

Báo cáo khoa học: A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis doc

... 5¢-TTGGAGAGGGCA ACTTTGG-3¢ and 5¢-CAGGATCGGTCGATTGTGC-3¢ (Stab Vida, Oeiras, Portugal) Acknowledgements ´ We thank Francisco Malagon and Francisco Navarro for their critical reading of the draft; ... Sigma (St Louis, MO, USA) Yeast strains, plasmids and media Yeast strains used are described in Table All MMY strains were constructed by standard genetic methods of tetrad analysis or transformation ... assayed acid phosphatase activity in eight congenic strains transformed with our five plasmids: four of the strains being wild-type for SPT6 and four of them having a spt6–140 allele The average...

Ngày tải lên: 07/03/2014, 12:20

14 435 0
Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

... nonlabelled Der p at day 30 displayed an airway in ammation 18 h after treatment, in the same magnitude as in animals challenged with a third HDM aerosol on day 30 (data not shown) The animals ... the Sel-tag had an intact core sequence and maintained allergen-specific IgE-binding epitopes and the use of a Sel-tag enabled labelling with the gamma-emitting radionuclide 75Se at a single predefined ... eosinophilic airway in ammation [28–30] Trafficking of dendritic cells to the airways and the lung epithelium was also demonstrated to be dramatically increased in mice with an allergic airway in ammation,...

Ngày tải lên: 07/03/2014, 21:20

12 519 0
w