a large membranous ventricular septal defect arrows is

... (4), defective (5) and insufficient (6) Y-axis: Percentage of patients Panel A: AVNRT Panel B: AVRT Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying ... EAT patients Panel A: Quantity and duration of episodes and the associated symptoms Panel B: Detraction in daily life generally and in parts of daily life variable PANAL A Detraction in daily ... to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes) All patients AVNRT AVRT EAT Fluoroscop time (Minutes) All patients...

Ngày tải lên: 03/11/2012, 11:44

... infundibular obstruction after administration of talazoline Four of the 27 patients presented an associated atrial septal defect One of them had a history similar to this case report At the age of year ... AVSD account for approximately 3% of all congenital heart diseases, frequently associated with other malformations such as in trisomy 21 [1] Additional cardiac abnormalities are found in about ... (Louis Pradel Hospital in Lyon, France) Pulmonary valvar was strongly calcified and narrow Outflow tract was muscular and thick The surgeon closed the atrial and ventricular parts of the ASVD,...

Ngày tải lên: 10/08/2014, 10:20

... Defibrillator Trial Investigators: Dual chamber pacing or ventricular backup pacing in patients with an implantable defibrillator: the Dual Chamber and VVI Implantable Defibrillator (DAVID) Trial JAMA ... medical therapy, our patient remained at NYHA functional class III She was upgraded to a cardiac resynchronization therapy (CRT)device with implantation of a lateral left ventricular lead (Figure ... systolic and diastolic ventricular function and cardiovascular morbidity and mortality Alternative RV pacing sites appear advantageous when compared to RVA pacing but their superiority has not...

Ngày tải lên: 10/08/2014, 23:20

... from hospital, and neurological rehabilitation was continued on an out-patient basis At that time our patient was breathing spontaneously, and the tracheostoma had healed; he was awake and responsive ... fulminating fat embolism syndrome caused by paradoxical embolism through a patent foramen ovale N Engl J Med 1993, 329:926-929 12 Kallina C, Probe R: Paradoxical fat embolism after intramedullary ... thrombocytes and consumptive coagulopathy (disseminated intravascular coagulation) Petechiae (punctuate bleeding) may appear on the trunk of the body as well as sub-conjunctivally as a delayed effect...

Ngày tải lên: 11/08/2014, 00:23

... TgATTTTAgCTgCATgTgCACCTgAgAA CgTCATggAAATgTCTTAATTggCTTgCTg gAAgAAAACAAATTgggAggAggAgAA gCgTgTTCCAAAgAACACAATTCAgTgCCTT BEC-32BamHI DX24BamHI ggATCCTgATCTgTggATTgggTTTCgTgg ggATCCgggTgTTgAACCAAAATgCgCCATT Method RT-PCR ... gAgTTggATgggTCCTCTgC CCAAACCAAAgCCAgTTTCATTCA CCAggTTTTgTATgAgTgCCgTA ACCTTggCCATCCTCTTCTT AgAAATCTTgACCCCCgTTC AAggAgCTCTTgACgTTggA TgCTAACAggTgggAAAACC CCTTCCAgCAgATgTggATT AgATTAggCAAggCgAggAT BEC87-GSP1 ... THA82-GSP1 THA-1-GSP2 LOX101-GSP1 LOX63-GSP2 TgCATTTCCAgCTTgCCTCCCACATTg CTgAgATCCCTAACAgCAAAgCTAgggATA ACCggTTCCggTggTggTgTgATgAACC ACTCATCAgTCTTAgTAggCTCgggTgTT TgATTTTAgCTgCATgTgCACCTgAgAA...

Ngày tải lên: 12/08/2014, 03:21

... ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, LOX1(reverse): CCTAGAGTCGCAGCAGCCAG, CD88(forward): TCAAGGTGGTGGTGGCAGTG, CD88(reverse): GTGACGATGGCTCCAGGAAGG, P21(forward): AGCAGCGGAACAAGGAGTCAG, ... microarray data and performed the statistical analysis AR conceived of the study, participated in its design, and wrote the manuscript All authors read and approved the final manuscript Acknowledgements ... as melt-curve analysis using the MyIQ system Primers used were (5' to 3'): β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG,...

Ngày tải lên: 13/08/2014, 09:20

... Zhongbai-83, Chinese kale (B oleracea var alboglabra) cv Xianggangbaihua, pakchoi cabbage (B rapa subsp chinensis) cv Jinchengteai, and Radish (R sativus var radicula) cv Manshenghong by the leaf-clipping ... the plant pathogen Ralstonia solanacearum Nature 2002, 415:497-502 Bhattacharyya A, Stilwagen S, Ivanova N, D'Souza M, Bernal A, Lykidis A, Kapatral V, Anderson I, Larsen N, Los T, et al.: Whole-genome ... Guangtou, pakchoi cabbage (B rapa subsp chinensis) cv Jinchengteai, pakchoi cabbage (B rapa subsp chinensis) cv Naibaicai, radish (R sativus var sativus) cv Cherry Belle, radish (R sativus var...

Ngày tải lên: 14/08/2014, 08:20

... [38] as well as a decoy database strategy and was found to be in the low percentage range Most tandem mass spectra as well as their statistical analysis can be viewed in the PhosphoPep database ... genome A complete re-analysis of the spectra from the Bodenmiller study was beyond the scope of this paper, but we were able to carry out an initial re-analysis against a locally generated database ... FlyBase, 3,818 from 6-frame translations of miscellaneous functional RNA (rRNA, small nuclear RNA (snRNA) and snoRNA) from FlyBase and 2,594 were generated from the 6frame translation of transcripts...

Ngày tải lên: 14/08/2014, 21:20

... design and statistical analysis of the study MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript revision All authors read and approved the final ... 27 Data are expressed as means ± standard deviation, unless stated otherwise APACHE, Acute Physiology and Chronic Health Evaluation; ICU, intensive care unit; IQR, interquartile range; SAPS, ... expected and new unexpected predefined major abnormalities in 2,457 daily routine chest radiographs Abnormalities Expected abnormalitiesa Abnormalities expected by the ICU physician Large atelectasis...

Ngày tải lên: 25/10/2012, 10:39

... Chemotherapy and Surgical Staging in EarlyStage Ovarian Carcinoma: European Organisation for Research and Treatment of Cancer–Adjuvant ChemoTherapy in Ovarian Neoplasm Trial J Natl Cancer Inst ... Bertelsen K, Jakobsen A, Stroyer I, et al A prospective randomized comparison of and 12 cycles of Cyclophosphamide, Adriamycin and Cisplatin in advanced epithelial ovarian cancer: a Danish ovarian study ... intraperitoneal alpha- 2a interferon Oncology 1992; 49:467-473 37 Barakat RR, Almadrones L, Venkatraman ES, et al A phase II trial of intraperitoneal cisplatin and etoposide as consolidation therapy...

Ngày tải lên: 03/11/2012, 09:57

... justification is that a page can have a high PageRank if there are many pages that point to it, or if there are some pages that point to it and have a high PageRank Intuitively, pages that are well ... "back" but eventually gets bored and starts on another random page The probability that the random surfer visits a page is its PageRank And, the d damping factor is the probability at each page ... get this data, mainly because it is considered commercially valuable Our final design goal was to build an architecture that can support novel research activities on large- scale web data To support...

Ngày tải lên: 24/01/2014, 20:20

... were used to amplify sequences from 16S rRNA, and primers COIH 2198 (5Ј TAAACTTCAGGGTGACCAAAAAATCA 3Ј) and COIL 1490 (5Ј GGTCAACAAATCATAAAGATATTGG 3Ј; Folmer et al 1994) were used to obtain sequences ... BC, Canada; (26) Campbell River, BC, Canada; (27) Ishikari River, Japan; (28) Lake Baratoka, Japan; (29) Lake Ohnuma, Japan; (30) Lake Akanko, Japan; (31) Caspian Sea; (32) Gulf of Bothnia; (33) ... Estuary, TX; (20) San Francisco Bay, CA; (21) Columbia River estuary, OR; (22) Chehalis River estuary, WA; (23) Grays Harbor Marsh, WA; (24) Nitinat Lake, BC, Canada; (25) Nanaimo River, BC, Canada;...

Ngày tải lên: 13/02/2014, 15:20

Ngày tải lên: 14/02/2014, 07:20

... numerically, with percentages of groups where applicable Variations within categories are shown as means with ranges where appropriate Comparative data between characteristics are displayed, and data ... tuberculosis, factors leading to admission, and induced toxicities, with resultant diminished disease awareness King Fahad National Guard Hospital is an 800-bed tertiary care hospital located in ... Respiratory failure is a leading cause of ICU admissions Other major causes are adult respiratory distress syndrome (ARDS), organ failure and dissemination of disease Unfortunately treatment...

Ngày tải lên: 15/02/2014, 12:20

... 529–540 Shimomura Y, Honda T, Shiraki M, Murakami T, Sato J, Kobayashi H, Mawatari K, Obayashi M & Harris RA (2006) Branched-chain amino acid catabolism in exercise and liver disease J Nutr 136, ... lethargy, developmental delay and sometimes acute neonatal death [2,3] Isovaleric acid, one of the derivatives of isovaleryl-CoA, is abnormally excreted in blood and causes a characteristic sweaty ... (C) Amino acid sequence alignment of IVDs from Pseudomonas aeruginosa PAO1 (bacteria, NP_250705), Arabidopsis thaliana (arabidopsis, NP_190116), Homo sapiens (human, NP_002216), Caenorhabditis...

Ngày tải lên: 18/02/2014, 04:20

... kDa ~850 kDa 670 kDa ~500 kDa 670 kDa 440 kDa 230 kDa 150 kDa 78 kDa 66 kDa 35 kDa ~35 kDa ~230 kDa ~500 kDa ~35 kDa ~500 kDa ~35 kDa ~230 kDa ~500 kDa cyt c1 cyt b ISP core core Qcr6p SDS-PAGE ... molecular mass calibration markers included thyroglobulin (670 kDa), apoferritin (440 kDa), catalase (230 kDa), alcohol dehydrogenase (150 kDa), conalbumin (78 kDa), albumin (66 kDa), and b-lactoglobulin ... oxidase complex was clearly demonstrated [10–12], but also in other organisms, such as Neurospora crassa [13], mammals [11] and plants [14] A higher-order organization of the respiratory chain...

Ngày tải lên: 18/02/2014, 08:20

... Pastry and Scribe are fully decentralized, all decisions are based on local information, and each node has identical capabilities Each node can act as a publisher, a root of a multicast tree, a subscriber ... Zhuang, Ben Y Zhao, Anthony D Joseph, Randy H Katz, and John Kubiatowicz Bayeux: An Architecture for Scalable and Fault-tolerant Wide-Area Data Dissemination In Proc of the Eleventh International ... multicast tree Pastry’s randomization properties ensure that the tree is well balanced and that the forwarding load is evenly balanced across the nodes This balance enables Scribe to support large...

Ngày tải lên: 19/02/2014, 18:20

... Association of Computational Linguistics (ACL), 124-131 E Charniak, K Knight and K Yamada 2003 Syntaxbased language models for statistical machine translation MT Summit IX., Intl Assoc for Machine ... International Colloquium on Grammatical Inference (ICGI), 97-111 K Yamada and K Knight 2001 A syntax-based statistical translation model The 39th Annual Conference on Association of Computational ... significantly Bear in mind that Charniak et al (2003) integrated Charniak’s language model with the syntaxbased translation model Yamada and Knight proposed (2001) to rescore a tree-to-string translation...

Ngày tải lên: 20/02/2014, 04:20

... clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative consultation, and ... coupling exists, as the OAAI is derived from both epidural rates and cesarean rates, it is precisely for this reason that this single denominator is a more reliable measure of activity than annual delivery ... this heterogeneity The obstetric anesthesia activity index (OAAI) The majority of anesthesia workload in the labor ward comprises epidural labor analgesia and cesarean delivery The OAAI is a...

Ngày tải lên: 05/03/2014, 15:20

... initiate Pabc deactivation The [cGMP] in OS is recovered by retinal guanylate cyclase We have recently shown that retinal guanylate cyclase is activated by a light-initiated, ATPstimulated and Ca2+-sensitive ... phosphodiesterase activity by the helical domain of transducin alpha subunit J Biol Chem 273, 34284– 34292 Yamazaki A, Yu H, Yamazaki M, Honkawa H, Matsuura I, Usukura J & Yamazaki RK (2003) A critical ... PDE6 regulation 33 34 35 36 37 38 39 40 41 42 43 A Yamazaki et al functionally relevant transient secondary and tertiary structure Proc Natl Acad Sci USA 105, 1505–1510 Yamazaki A, Yamazaki M, Tsuboi...

Ngày tải lên: 06/03/2014, 00:21