... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism ... AGGCAGTCCGTAACATCCAC, Reverse; CTTCAGTCCGTAACATCCAC) and STIM2 (Forward; TCCCTGCATGTCACTGAGTC, Reverse; GGGAAGTGTCGTTCCTTTGA) Cycling was performed 35 times; 94°C, followed by 55°C (annealing temperature),...
Ngày tải lên: 12/08/2014, 16:20
... nowadays Although the literature provides evidence that an all-progressive chain gives at least as good an image quality as an all-interlaced chain with the same channel bandwidth, recent research ... visual information Until a few years ago, digital image communication research was still confined to universities and research laboratories of telecommunication or broadcasting companies Nowadays, ... storage media Moreover, personal computers and workstations have become important platforms for multimedia interactive applications that advantageously use a close integration of digital compression...
Ngày tải lên: 10/12/2013, 14:15
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
... and its derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA ... ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL *******NNN *******SSS *******PPP chloroplasts used for this assay [15] Furthermore, the intermediate and mature forms of Toc75 in a ... apparatus, faces the stromal compartment J Biol Chem 273, 16583–16588 Gunasekaran K, Nagarajaram HA, Ramakrishnan C & Balaram P (1998) Stereochemical punctuation marks in protein structures: glycine and...
Ngày tải lên: 19/02/2014, 07:20
International Labor Migration: A Responsible Role for Business pdf
... Lanka, Thailand, and Vietnam » estination Country Participants: Bahrain, Italy, Kuwait, Malaysia, Qatar, D Republic of Korea, Saudi Arabia, and United Arab Emirates In January 2008, the Abu Dhabi ... Saudi Arabia 383,031 United Arab Emirates 18,551 Egypt Unknown Jordan 16,821 Malaysia 85,835 Oman 31,317 Qatar Unknown Saudi Arabia 114,981 United Arab Emirates 6,443 Jordan Malaysia Pakistan ... available in villages and towns » Make the passport and visa application process more straightforward South-South Labor Migration Flows Jordan Egypt Kuwait Saudi Arabia Qatar U .A. E Pakistan India...
Ngày tải lên: 15/03/2014, 21:20
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... Darmstadt, Germany) The samples were separated using a solvent of chloroform/ methanol/water (65 : 35 : 7, v/v/v) Authentic lipid standards (Avanti Polar Lipids, Alabaster, AL, USA) were separated ... determined by an ELISA method All incubations were performed at room temperature An ELISA plate (Nunc Maxisorb) was loaded with 100 lL antihuman TNF -a mouse monoclonal capture antibody (R&D, Minneapolis, ... added After incubating for h, the plate was washed, 100 lL streptavidin–horseradish peroxidase conjugate (0.6 lgÆmL)1, Zymed, San Francisco, CA, USA) added and the plate incubated for 20 The plate...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... tetrameric form (99%) was for the b chain This estimation was made on the basis of the results by McDonald et al [16] In a previous paper [8], we have reported that the separated a and b chains are ... usual acidic met-form but for an admixture with hemichrome For the oxidation product of separated b chains, we have already carried out 8K EPR analysis in 10 mM maleate buffer at pH 6.2 [8] In addition ... stable and more loosely packed than its a1 b1 counterpart in HbO2 At all rates, the present spectral examinations clearly indicate that the formation of the a1 b1 or a2 b2 contact suppresses remarkably...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "A proinflammatory role for Fas in joints of mice with collagen-induced arthritis" docx
... instructions Anticollagen antibody assay Sera were collected from control DBA-lpr/+ and mutant DBA-lpr/lpr mice before immunization and at days 20 and 47 after immunization and a standard ELISA was used ... original inbred strains Arthritis Rheum 2002, 46:1067-1074 Sugiyama M, Tsukazaki T, Yonekura A, Matsuzaki S, Yamashita S, Iwasaki K: Localization of apoptosis and expression of apoptosis related ... 93:1029-1034 Amasaki Y, Kobayashi S, Takeda T, Ogura N, Jodo S, Nakabayashi T, Tsutsumi A, Fujisaku A, Koike T: Up-regulated expression of Fas antigen (CD95) by peripheral naive and memory T...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx
... 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ activated at 95°C for 10 minutes followed by 45 cycles of denaturing at ... No 81 NM_031512 Forward: 5’-ATATGTTCTCAGGGAGATCTTGGAA-3’ 80 NM_031512 Reverse: 5’-ACGGGTTCCATGGTGAAGTC-3’ IL-6 Reverse: 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 ... Animal work and handling were complied with the National Health and Research Council (Australia) Code of Practice for Animal Care in Research and Teaching (2004) [13] RNA extractions Total RNA was...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Atherosclerotic disease is increased in recent-onset rheumatoid arthritis: a critical role for inflammation" ppsx
... sedimentation rate, and the patient global assessment of disease activity (100 mm visual analogue scale) [15] Cardiovascular risk factor ascertainment CV risk factors were ascertained among RA patients ... first maximum slope of the change in signal for the near and far walls, and repeating the analysis to identify the media–adventitia interface The software calculates the mean and standard deviation ... Statistical analysis Continuous variables are described as the mean ± standard deviation, and categorical variables presented as the percentage Log transformations were applied to non-normally...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx
... study, ANA staining, saliva collections, data analyses, and manuscript preparation All authors read and approved the final manuscript Proposed genetic predisposition for and fatty acid homeostasis/trans6.NOD-Aec1Aec2 ... O-acyltransferase-1 (SOAT-1) using FCs and free fatty acids (FFAs) ABCA1, ATP-binding cassette, subfamily A [ABC1] member 1; ACAT, acyl-coenzyme A: cholesterol acyltransferase; ApoE, apolipoprotein ... primarily the pathophysiological and biochemical abnormalities that subsequently result in the activation of the autoimmune attack against the submandibular and lacrimal glands [10], is a single...
Ngày tải lên: 09/08/2014, 13:22
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx
... altered sulphate compartmentalization BMC Plant Biol 2010, 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate ... SULTR1.1 and SULTR1.2, in Arabidopsis Plant Physiol 2008, 147:897-911 Maruyama-Nakashita A, Nakamura Y, Tohge T, Saito K, Takahashi H: Arabidopsis SLIM1 is a central transcriptional regulator of plant ... Arabidopsis mutants for the group sulfate transporters indicates a role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Study of ‘Redhaven’ peach and its white-fleshed mutant suggests a key role of CCD4 carotenoid dioxygenase in carotenoid and norisoprenoid volatile metabolism" ppsx
... each ripening stage of RH and RHB The variable set was made of the major 41 volatile aroma compounds PCA involves a mathematical procedure that transforms a number of possibly correlated variables ... Plant Physiol 2009, 166:1241-1252 Han SY, Kitahata N, Sekimata K, Saito T, Kobayashi M, Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K, Yoshida S, Asami T: A novel inhibitor of 9-cis-epoxycarotenoid ... with maxima in the range of hundreds of μg/g fresh weight The two genotypes displayed similar ripening-associated patterns for aromatic and branched chain amino acid-, fatty acid-, and furanrelated...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx
... Materials and methods Gene datasets TCGA Data were obtained from The Cancer Genome Atlas (TCGA) database This dataset comprises of molecular characterizations from 373 GBM patients For each patient, ... state, and (iii) of the complementary event Survival analysis Kaplan-Meier survival analysis was done on all pathway measurements in all five datasets [21], through clinical data (Vital Status) ... scores (a score for each pathway in the database) to each sample in every dataset Network information has been obtained from The National Cancer Institute's Pathway Interaction Database (PID) [12]...
Ngày tải lên: 11/08/2014, 12:21
Báo cáo y học: "A crucial role for tumor necrosis factor receptor 1 in synovial lining cells and the reticuloendothelial system in mediating experimental arthritis" pps
... statistical and data analysis, interpretation of data, and drafting of the manuscript WBvdB conceived of the study and helped draft the manuscript All authors read and approved the final manuscript ... 5'-TCTAGAGATCCGACGCCGCCATCTCTA-3' and reverse 5'-GTCGACGTTAACAAGGCTTTTCTCCA-3' The target sequence for silencing the Tnfrsf 1a gene [EMBL:M60468] was ATCTTCGGTCCTAGTAACT (base pairs 1095 to 1113), and we used ACTCATGTCTTGATCAGCT ... of TNFR1 may be a promising and safer approach for TNFα blockade in RA patients Page 10 of 11 Additional material Additional file Supplemental Methods Primerdesign Abbreviations APC: antigen-presenting...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx
... bactin, 5’-TGGCACCCAGCACAATGAA-3’; and reverse primer for human b-actin, 5’-CTAAGTCATAGTCCGCCTAGAAGCA-3’ Primer efficiency was determined by serially diluting a standard RT reaction product PCR ... and the experimental results are comparable Additional file in the supplementary materials summarizes the epidemiological data All AS, RA and OA patients got treatment with NSAIDs Synovial samples ... criteria for AS Patients with AS and RA took disease-modifying antirheumatic drugs (DMARDs) before surgery Patients with AS, RA and OA were also medicated with non-steroidal anti-inflammatory...
Ngày tải lên: 12/08/2014, 17:22
Báo cáo khoa học: "Acute pancreatitis: a possible role for activated protein" pps
... Nitric oxide regulates bacterial translocation in experimental acute pancreatitis Pancreatology 2003, 3:329335 11 Iba T, Kidokoro A, Fukunaga M, Nagakari K, Shirahama A, Ida Y: Activated protein C ... of established necrotizing pancreatitis has important clinical implications Indeed, one explanation for the therapeutic failure of the PAF antagonist lexipafant is that it might have been administered ... mortality in acute pancreatitis [9] Translocation of enteric bacteria from the intestine is postulated to play an important role in the development of this complication In the study by Yamanel and coworkers...
Ngày tải lên: 12/08/2014, 22:21
Báo cáo y học: "A Functional Role for ADAM10 in Human Immunodeficiency Virus Type-1 Replication" pptx
... were against positions 1119-1138 (5’ CCCAAAGTCTCT CACATTA-3’), 1272-1280 (5’-GGACAAACTTAAC AACAAT-3’), 1591-1609 (GCAAGGGAAGGAATATGTA-3’), and 2070-2088 (5’-GCTAATGGCTGG ATTTATT-3’) TZM-bl and ... Mukherjee P, Narayanasamy K, Arora R, Sen SD, Gupta S, Natarajan K, Malhotra P: Proteome analysis of Plasmodium falciparum extracellular secretory antigens at asexual blood stages reveals a cohort ... Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono Y, Oshima Y, Nakamura K, Seiki M, Tanaka S: Negative regulation of osteoclastogenesis by ectodomain shedding of receptor activator of NF-kappaB...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Host-virus interaction: a new role for microRNAs" pdf
... microRNAs can act as a trans-acting element for reversible and dynamic regulation of spatial and temporal protein expression Computational tools for discovery of microRNA and their targets Computational ... (shRNAs) can saturate the RNA interference machinery [17] This would have far reaching implications on determining dosage of artificial microRNAs for therapeutics as well as for experimental research ... important as siRNA based therapeutics for viral pathogens in different stages of clinical trials and are showing promising results Artificial microRNAs (amiRNAs) and microRNA engineering MicroRNAs...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: "Breakdown of accommodation in nerve: a possible role for persistent sodium current" potx
... obtaining a value for internodal leak resistance on the basis of experimental data alone For these reasons we believe that the present approach was justified Alternative explanations of breakdown ... error to a value that would enable the model to reproduce known experimental data This approach was used since few experimental data on the internodal leak resistance are available There are only ... nodal capacitance in experimental data and the nodal capacitance per square micrometer [39] The nodal resting potential was kept stable by a current leak to the internode, and the internodal...
Ngày tải lên: 13/08/2014, 22:22
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... CAGGGTTTGGCCGATACTTA Primer Alias Sequence 1247 RNR3R CTTCTTTTTGGGCCAATTCA 1280 BNA2 5' CTCGACGCTGATTGGCTAA 1248 YKL161CF TGGCCGAACTACTTGGTAGG 1281 BNA2 3' 1249 YKL161CR GCAATGTTTCCTCAGGTGGT GTAACCAGTACGAAAAAAGATA...
Ngày tải lên: 14/08/2014, 21:20