a key requirement for evolution

... nowadays Although the literature provides evidence that an all-progressive chain gives at least as good an image quality as an all-interlaced chain with the same channel bandwidth, recent research ... visual information Until a few years ago, digital image communication research was still confined to universities and research laboratories of telecommunication or broadcasting companies Nowadays, ... storage media Moreover, personal computers and workstations have become important platforms for multimedia interactive applications that advantageously use a close integration of digital compression...

Ngày tải lên: 10/12/2013, 14:15

... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... AGGCAGTCCGTAACATCCAC, Reverse; CTTCAGTCCGTAACATCCAC) and STIM2 (Forward; TCCCTGCATGTCACTGAGTC, Reverse; GGGAAGTGTCGTTCCTTTGA) Cycling was performed 35 times; 94°C, followed by 55°C (annealing temperature), ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism...

Ngày tải lên: 12/08/2014, 16:20

... mechanisms SPBs shall carry an RSA private key [8] and a matching digital certificate stating their role, as to allow authentication by a Security Manager or another SPB After physical installation, ... of actual content like image, audio or subtitle data, plus metadata A compliant track file is a self-contained instance that can be interpreted by a compliant decoder A track file starts with a ... manufacturers now act as their own CA, and since certification became optional, the requirements for standard compliance became less strict In fact, equipment manufacturers defined an informal...

Ngày tải lên: 07/03/2014, 14:20

... Boxes, Glocalization, and Networked Individualism” Pp 10-25 in Digital Cities II: Computational and Sociological Approaches, edited by Makoto Tanabe, Peter van den Besselaar and Toru Ishida Berlin: ... laws They have their “ways of doing things” that may vary among the members These organizational and environmental factors can influence the behaviour and outcome of the community So paying attention ... environmental factors Key factors for a successful online community ORGANIZATIONAL AND ENVIRONMENTAL FACTORS: SOME USEFUL QUESTIONS • How does organizational power and control show up within and around...

Ngày tải lên: 08/03/2014, 20:20

... Collaborative Computational Project N (1994) The CCP4 suite: programs for protein crystallography Acta Crystallogr D 50, 760–763 18 Navaza J (1994) AMoRe: an automated package for molecular replacement ... Diffraction data were collected at 100 K on Beamline BL44B2 at SPring-8 (Harima Institute, Hyogo, Japan) using an ADSC Quantum 210 CCD detector (Area Detector Systems ˚ Corporation, Poway, CA, USA) ... procedure (Stratagene) with primers 5¢-TCTTCAGCGGC ATGGGCGACCTCGGCGGCAT-3¢ and 5¢-ATGCCGC CGAGGTCGCCCATGCCGCTGAAGA-3¢ The recombinant protein was purified using a HiTrapÔ chelating column and Resource...

Ngày tải lên: 23/03/2014, 05:22

... thylakoid membranes isolated from Cheaeotoceros gracilis (A) , Pavlova gyrans (B), Laminria japonica (C) and Undaria pinnatifida (D) with antibodies raised against various extrinsic proteins Lane ... sequence data or functional requirements (see text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae ... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana...

Ngày tải lên: 23/03/2014, 15:21

... is based on the levels of assessment and appraisal as shown in Table The appraisal of health care services presumes that preferences can be measured and can be made available to the policy and ... at least as important as the reduction of an elevated HBA1c (Tables and 3) This means that weight loss and reduction of an elevated HBA1c may be used as equivalent endpoints in pragmatic trials, ... with the Adaptive Conjoint Analysis (ACA) software 1997 (Sawtooth Software, Inc., Sequim, Washington, USA) Like the most established approaches in conjoint analysis the ACA is based on a main-effects...

Ngày tải lên: 20/06/2014, 15:20

... threat After capturing a node, an attacker can gain additional advantage by selectively eavesdropping on nodes that are known to share keys with the captured one To prevent this attack, the key ... KAIS: An International Journal on Knowledge and Information Systems and a Member of the Editorial Board of IJBRA International Journal of Bioinformatics Research and Applications She is a Member ... Lab at the Department of Computer Science and Engineering, the University of Texas at Dallas Her research interest is mainly in database systems, especially in spatial database with applications...

Ngày tải lên: 22/06/2014, 22:20

... database Statistical Analysis All descriptive statistics were presented as means and standard deviations for continuous variables, and as absolute and relative frequencies for categorical variables ... in dialysis or have you had a kidney transplantation?”); at least one macrovascular complication ("Has a doctor told you that you have had a myocardial infarction, angina?”, “Have you Medical reimbursements ... France and the National Association for Diabetes Networks Coordination initiated a large study named ENTRED [14], which included information about diabetes-related psychological and behavioral...

Ngày tải lên: 12/08/2014, 01:21

... CAAAATTCCATGACAATTGTGGTGGAATGCCACTAGAAA - PFV-1 - CAGAGATAGGTTTGAATGTTGTTACAGTTTGGAACAAGA - Scramble sequence no - GAAAATCTCTAGCAGTACTGGAAGGGCTAATTCACTCCC - HIV-1 LTR-LTR WT no - CAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAG ... GTC ATG GAA TTT TGT ATA TTG ATT ATC CTA AGG-3'), U3 B (5'ATT GTG GTG GAA TGC CAC TAG AAA T-3'), U 3A (5'ATT TCT AGT GGC ATT CCA CCA CAA T-3'), LTR-LTRB (5'-CCT TAG GAT AAT CAA TAT ACA AAA TTC CAT ... origin cleavage ( PFV IN ) LTR-LTR WT yes ** ** * *** * * * - CAAAAAACGATGAGTATGTAGGTCCATTGCCACTAGAAA - LTR-LTR mutant no ** * ** - CAAAATTCCATGATTATTATGGTTTAATGCCACTAGAAA - LTR-LTR mutant...

Ngày tải lên: 13/08/2014, 09:21

... of statistical databases for LRFD calibration, e.g maintenance, operations and geotechnical databases Development of performance standards for security Completion and adoption state-of-the-art ... professional training (including practices, materials and policies) Development of educational materials (materials appropriate to undergraduate education as opposed to available professional education ... be warranted Additionally, there are areas of the specification that are currently undergoing major revision A new conditional evaluation manual including the load and resistance factor rating...

Ngày tải lên: 06/09/2012, 14:24

... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate cancer Hinyokika ... (brachytherapy) [7] iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen deprivation therapy (ADT) that may be performed by bilateral orchiectomy ... 84-90 Stathopoulos GP, Koutantos J, Vaslamatzis MM, Athanasiadis A, Papadopoulos G, Labrodimou G, Stathopoulos J, and Rigatos S Survival after cytotoxic chemotherapy in patients with advanced hormone-resistant...

Ngày tải lên: 26/10/2012, 09:48

... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...

Ngày tải lên: 31/10/2012, 14:59

... chapter: Generative and Discriminative classifiers McGraw-Hill, New York www.cs.cmu.edu/tom/newchapters.html [22] T S Jayram, Rajasekar Krishna-murthy, Sriram Raghavan, Shivakumar Vaithyanathan, ... challenges about scalability and adaptability of the previous approaches We have then adapted the probabilistic framework to a Vietnamese domain - real estate In practical, the results increased of ... to obtain the desired information in an efficient and direct manner Currently, there is a lot of information available in structured format on the web For example, an apartment on real estate website...

Ngày tải lên: 23/11/2012, 15:04

... extract is an example of academic register, used, for instance, in dissertations and academic journals This typically uses cautious language like apparent and often, as well as academic vocabulary ... ‘There are so many strains of malaria parasite,’ said one scientist, ‘and each is able to alter its chemical surface and trick its way past the body’s defences We’d need a remarkable vaccine ... topics are examined and compared, one after another c) For and against – the advantages and disadvantages of two systems are discussed Complete the plan for the title in (1) using ideas from (1) a) ...

Ngày tải lên: 18/03/2013, 01:44

... transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's bank ... can spare or days, you are advised to visit Vientiane, Laos capital with legendary pagodas such as Srisakhet Hortakeo, Thatluang From Hanoi, many interesting tours are available because they are ... professional editor for creating and managing Web sites and pages Because it incorporates all of Dreamweaver's page design and site management tools, UltraDev makes it easy to create, manage, and edit...

Ngày tải lên: 07/04/2013, 23:51

... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach’s accompanying high rate of false positives There are ... anomaly behavior or not As demonstrated in [11], a basic assumption of anomaly detection is that attacks differ from normal behavior But the definition of what’s normal and what’s abnormal is ambiguous ... bottleneck of the performance of the cloud III Virtualization as an indispensable ingredient for almost every cloud realizes the abstraction that all the applications appear to the users as if they were...

Ngày tải lên: 31/07/2013, 09:43

... scheme cannot defend against replay attacks when attackers repeatly transmit authentication messages to server Liang Yan et al [8] adopted federated identity management together with hierarchical ... security requirements for three deployment models and three cloud service models For IaaS and PaaS, identification and authentication are listed as mandatory for the three deployment models Proper authentication ... servers for new VMs via SSL 885 times of hash operations for signature and times of ê operations for verification The comparisons for computation costs are shown in Table and Table As to the key...

Ngày tải lên: 31/07/2013, 09:44

... (noun) analogy(noun) analogous (adj) anticipate (verb) in anticipation of (phrase) apparent (adj) appreciable (adj) appreciably (adv) appreciate (verb) appreciation (noun) arbitrary (adj) arbitrarily ... humanitarian/financial/technical/medical assistance emergency/disaster/development assistance an assistance package/programme ►p h r a ses: A C A D E M IC W O R D advice and assistance aid and assistance ... /aegraveit/ (aggravates, aggravating, aggravated) If someone or something aggravates a situation, they make it worse, o Stressand lack of sleep can aggravate the situation, o irritants which cause...

Ngày tải lên: 30/08/2013, 23:06