a hybrid chip for genomics and proteomics

plant genomics and proteomics -  christopher a. cullis

plant genomics and proteomics - christopher a. cullis

... Genus Cardamine Arabidopsis Rosa Luzula Oryza Rosa Gnetum Zea Nicotiana Ginkgo Allium Pinus Fritillaria Species 1C pg amara thaliana wichuraiana pilosa sativa moyesii ula mays tobaccum biloba sativum ... databases that house all this information so that the data can be accessible both immediately and in an archival form D ATABASES The creation of biological databases represents a fundamental change ... experimental detail and observations span very diverse plant material, rather than all being available in a convenient single model organism Thus algae may be appropriate models for photosynthesis and...

Ngày tải lên: 08/04/2014, 13:07

218 323 0
Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt

Báo cáo hóa học: " Strong convergence of a hybrid method for monotone variational inequalities and fixed point problems" ppt

... inequalities Carpathian J Math 24, 139–148 (2008) He, BS, Yang, ZH, Yuan, XM: An approximate proximal-extragradient type method for monotone variational inequalities J Math Anal Appl 300, 362–374 ... nonlinear variational problems Springer, New York (1984) Iusem, AN: An iterative algorithm for the variational inequality problem Comput Appl Math 13, 103–114 (1994) Yao, JC: Variational inequalities ... contributions All authors participated in the design of the study and performed the converegnce analysis All authors read and approved the final manuscript Competing interests The authors declare that they...

Ngày tải lên: 20/06/2014, 22:20

10 425 0
A Hybrid Method for a System Involving Equilibrium Problems Variational Inequalities and Nonexpansive Semigroup

A Hybrid Method for a System Involving Equilibrium Problems Variational Inequalities and Nonexpansive Semigroup

... Hilbert spaces, Journal of Mathematical Analysis and Applications 318 (2006) 43–52 [10] N Nadezhkina and W Takahashi, Strong convergence theorem by a hybrid method for nonexpansive mappings and Lipschitz ... the variational inequality (2) and the fixed point problem for a group of nonexpansive mappings are important topics of Applied Analysis, and they attracted much attention of researchers and users ... (x) 2 for all x, y ∈ H; for any x ∈ H and for all y ∈ C Using Lemma 2.1, it is easy to prove the following lemma Lemma 2.2 A point u ∈ C is a solution of the variational inequality (2) if and...

Ngày tải lên: 14/10/2015, 08:17

16 177 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

... Specialty Product A B C D Mass Market Niche Market F Bibliography Essel, A E 1993 Niche marketing—An alternative for small and part-time farmers Farm Management Update Blacksburg, VA: Virginia Tech ... Graduate Research Assistant Department of Wood Science and Forest Products Virginia Polytechnic Institute and State University Blacksburg, VA Published by: Northeastern Area State and Private Forestry ... instead They were transformed into marketing managers, marketing engineers and marketing associates, and some even became marketing representatives.” —Lamont C Blake Marketing Consultant As can...

Ngày tải lên: 18/02/2014, 22:20

92 2,2K 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

... Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Automata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... algorithm to estimate the counts of multigrams The algorithm has a forward variable α and a backward variable β which are calculated in the standard way (Deligne and Bimbot, 1995) Consider a node r which ... and North American Association for Computational Linguistics Conference, Edmonton, Canada A Kumaran, Mitesh M Khapra, and Haizhou Li 201 0a Report of NEWS 2010 transliteration mining shared task...

Ngày tải lên: 19/02/2014, 19:20

9 521 0
Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

... Proceedings of ACL Y Ma, N Stroppa, and A Way 2007 Bootstrapping word alignment via word packing In Proceedings of ACL L Nepveu, G Lapalme, P Langlais, and G Foster 2004 Adaptive language and translation ... train TransAhead, we used British National Corpus and Hong Kong Parallel Text and deployed GENIA tagger for POS analyses To evaluate TransAhead in CAT and CALL, we introduced it to a class of 34 ... interactivity made translation and language learning more fun and the participants found TransAhead very recommendable and would like to use the system again in future translation tasks Acknowledgement...

Ngày tải lên: 22/02/2014, 03:20

4 393 0
Tài liệu A Science Roadmap for Food and Agriculture pdf

Tài liệu A Science Roadmap for Food and Agriculture pdf

... interfaces between animal agriculture and landscapes (natural, managed, and urban) New initiatives to characterize the genetic architecture and resources of various agriculture animals and aquaculture ... more accurate estimates of climate change impacts, the potential costs and benefits of adaptation, and to validate and calibrate models • Quantify costs and benefits of adaptation at the farm ... collaborations and data exchange systems that establish food security and safety • National policies for systems-based sustainable production of abundant and safe food • Standardized management systems and...

Ngày tải lên: 22/02/2014, 05:20

104 415 0
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

... the translations we have allocated to the lexical items in our vocabulary will be generated Tibia is true of all NL s!/stems that translate from a natural language into some formal representation ... system are acceptable as they are proposed, is more flexible than any approach which depends on getting a reaiisable expression of the representation language from the application program and systematically ... approach to generating text from a given logical form is described The algorithm described by Shieber and his colleagues takes a realisable A- calculus expression and uses their syntactic/semantic...

Ngày tải lên: 22/02/2014, 10:20

4 502 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... is variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children ... John Ward, Dale Hu, Cindy Weinbaum, and David Bell, Centers for Disease Control and Prevention; Chris Taylor and Martha Saly, National Viral Hepatitis Roundtable; Lorren Sandt, Caring Ambassadors ... hepatitis B and hepatitis C and guidance on reducing them Information about health disparities related to hepatitis B and hepatitis C To increase knowledge and awareness about hepatitis B and...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... and C http://www.nap.edu/catalog/12793.html Acronyms and Abbreviations AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC American Association for the Study of Liver Diseases ... childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates than non-Hispanic white children Regarding vaccination of children and ... aminotransferase Hepatitis B core antibody Hepatitis B surface antibody Hepatitis C antibody Asian and Pacific Islander aspartate transaminase adult viral hepatitis prevention coordinators CDC CHIP CI CIA...

Ngày tải lên: 06/03/2014, 01:20

253 370 0
Hate on the Internet: A Response Guide for Educators and Families pptx

Hate on the Internet: A Response Guide for Educators and Families pptx

... Partners Against Hate Hate on the Internet: A Response Guide for Educators and Families represents a collaborative effort of the Anti-Defamation League (ADL), National Chair, Barbara Balser and ... sites that include hate propaganda from the National Alliance and David Duke “If you are a teacher or student, I hope you will take a stand for right and wrong and use this information to enlighten ... 15 The National Alliance Web site features transcripts from a weekly anti-Semitic radio broadcast, online access to many articles from the group’s National Vanguard magazine, and a catalog of...

Ngày tải lên: 06/03/2014, 21:20

63 1,4K 0
Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

... folding catalysts (reactivation assay) The catalytic activity of (A) SsMTAPII and SsMTAPIIC259S ⁄ C261S and (B) PfPNP and PfPNPC254S ⁄ C256S was then measured under standard assay conditions The activity ... was analyzed by catalytic activity measurements performed under standard conditions Reactivation assay of SsMTAPII, PfPNP and their CXC-lacking mutants The activity of SsCSC and PfCGC as catalysts ... concentration of mm was then added and A2 96, as a result of RNase-catalyzed cCMP hydrolysis, was monitored continuously for 210 at 30 °C The positive control was the reactivation of sRNaseA catalyzed...

Ngày tải lên: 07/03/2014, 00:20

7 496 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... membrane was from Millipore (Bedford, MA, USA) Goat polyclonal anti-(yeast Vps4p) IgG was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and rabbit polyclonal anti-(carboxypeptidase Y) and anti-calmodulin ... Francisco, CA, USA) Horseradish peroxidaseconjugated goat anti-(mouse IgG) and gel-filtration standards were from Bio-Rad Laboratories (Hercules, CA, USA) Penta His mAb and Ni-NTA agarose were from Qiagen...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Acute and Chronic Sinusitis - A Practical Guide for Diagnosis and Treatment docx

Acute and Chronic Sinusitis - A Practical Guide for Diagnosis and Treatment docx

... sinus ostia to allow adequate drainage and aeration • Senior BA, Kennedy DW Management of sinusitis in the asthmatic patient AAAI J,1996;77:6-19 0031003 Development of Sinuses • Maxillary and ethmoid ... Physicians supported by an educational grant from Aventis Pharmaceuticals The AAFP gratefully acknowledges Harold H Hedges, III, M.D and Susan M Pollart, M.D for developing the content for the AAFP ... • Nasal polyps • Congenital atresia • Lymphoid hyperplasia • Nasal structural changes found in Downs syndrome 0031003 27 Vasculitides, Autoimmune and Granulomatous Diseases • Churg-Strauss vasculitis...

Ngày tải lên: 16/03/2014, 14:20

81 535 0
Determinants of General Health Status and Specific Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany doc

Determinants of General Health Status and Specific Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany doc

... Diseases of Elderly Women and Men: A Longitudinal Analysis for Western and Eastern Germany Christian Wegner and Marc Luy Introduction In general, the health status at old age has an important ... classified in detail All analysed health variables were dichotomised into ‘good’ and ‘bad’ in the case of the general health status and into ‘presence’ and ‘absence’ for each specific disease and multimorbidity ... information about the age at starting and the age at quitting to smoke Using these data we calculated the number of smoking years (measured as a continuous variable) and combined this information...

Ngày tải lên: 22/03/2014, 13:20

61 545 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

... and Adult Viral Hepatitis Coordinator, Bureau of Infectious Disease Prevention, Response, and Services, Massachusetts Department of Health, Jamaica Plain, Massachusetts Alison A Evans Assistant ... populations room as soon as they are stable and washed School-entry mandates have been shown to increase hepatitis B vaccination rates and to reduce disparities in vaccination rates Therefore, ... hepatitis B and hepatitis C are important public health problems and that there are several barriers to prevention and control efforts, such as a lack of knowledge and awareness about chronic...

Ngày tải lên: 22/03/2014, 17:20

4 405 1
A GENERAL HISTORY FOR COLLEGES AND HIGH SCHOOLS potx

A GENERAL HISTORY FOR COLLEGES AND HIGH SCHOOLS potx

... races and families have given way before the advance of the Aryan peoples, who have assumed the position of leaders and teachers among the families of mankind, and are rapidly spreading their arts ... of many of the Pacific islands; (3) the nomads (Tartars, Mongols, etc.) of Northern and Central Asia and of Eastern Russia; (4) the Turks, the Magyars, or Hungarians, the Finns and Lapps, and ... Indian religion is known as Brahmanism Brahma, an impersonal essence, is conceived as the primal existence Forth from Brahma emanated, as heat and light emanate from the sun, all things and all...

Ngày tải lên: 22/03/2014, 22:20

987 262 0
w