a human rights and apos just satisfaction apos

The return of universalist law - human rights and free trade

The return of universalist law - human rights and free trade

... practice disadvantages and marginalises females.81 Valuing human rights and the sanctity of individual human life are obviously not exclusively European norms What today are thought about as ... nation and apply to all of humanity Human rights evidence the natural laws and natural rights of our time – patterned on a recurring legal need for social theology and now philosophy Until about ... globalisation – what social justice advocates might consider ‘good globalisation’ The International Labour Organization and Amnesty International stand as two examples of a trend which features...

Ngày tải lên: 01/11/2013, 08:20

40 532 0
HUMAN RIGHTS AND GENDER EQUALITY IN HEALTH SECTOR STRATEGIES pdf

HUMAN RIGHTS AND GENDER EQUALITY IN HEALTH SECTOR STRATEGIES pdf

... David Evans, Samantha Figueroa Garcia, Bob Fryatt, Michelle Funk, Monika Gehner, Sabrina Hassanali, Hans Hogerzeil, Sowmya Kadandale, Rania Kawar, Eszter Kismodi, Jennifer Knoester, Alexandra ... Musoba, Juliet Nabyonga, Kellen Namusisi and Olive Sentumbwe Yemen – Mona Al Mudwahi, Eman Al Kobaty, Fatima Elawah and Jameela Al Raiby Zambia – Nicholas Chikwenya, David Chimfembwe and Vincent ... health These areas require urgent attention in a gender and human rights- based approach to women's health The Declaration of Alma-Ata, adopted at the Alma-Ata Conference of 1978 on Primary Health...

Ngày tải lên: 05/03/2014, 13:20

166 830 1
American Bioethics: Crossing Human Rights and Health Law Boundaries pot

American Bioethics: Crossing Human Rights and Health Law Boundaries pot

... 0-19-516949-2 Human rights Moral and ethical aspects Medical laws and legislation—Moral and ethical aspects Medical laws and legislation—Moral and ethical aspects—United States Bioethics—United States ... equality are better recognized today Human Rights and Health 25 Human Rights and Physicians Both medical ethics and human rights are aspirational and difficult to enforce Over the past two decades ... Rights and Health The Universal Declaration of Human Rights and the two subsequent treaties form a global human rights framework for action and have a special relevance for global health The relationship...

Ngày tải lên: 07/03/2014, 10:20

261 344 0
Imprisonment and women’s health: concerns about gender sensitivity, human rights and public health pdf

Imprisonment and women’s health: concerns about gender sensitivity, human rights and public health pdf

... población y las desigualdades suponen tanto un reto como una oportunidad para los sistemas sanitarios de cada país Las altas tasas de encarcelamiento en muchos países, el hacinamiento resultante, ... género y la injusticia social en las prisiones Existen pasos inmediatos que se podrían tomar para solucionar la desatención de la sanidad pública, los abusos de derechos humanos y la falta de sensibilidad ... resultante, las características de las poblaciones privadas de libertad y la prevalencia desproporcionada de problemas sanitarios en las prisiones deben convertir la salud en las prisiones en un asunto...

Ngày tải lên: 14/03/2014, 14:20

6 350 0
WHO RESOURCE BOOK ON MENTAL HEALTH, HUMAN RIGHTS AND LEGISLATION doc

WHO RESOURCE BOOK ON MENTAL HEALTH, HUMAN RIGHTS AND LEGISLATION doc

... Technical contribution and critiques Beatrice Abrahams Adel Hamid Afana Thérèse A Agossou Bassam Al Ashhab Ignacio Alvarez Ella Amir Paul S Appelbaum Julio Arboleda-Florez Begone Ariño Joseph Bediako ... Czeslaw Czabala Araba Sefa Dedeh Paolo Delvecchio Nimesh Desai M Parameshvara Deva Amita Dhanda Aaron Dhir Kate Diesfeld Robert Dinerstein Saida Douki Moera Douthett Claire Dubois-Hamdi Peter Edwards ... Martin Brown Anh Thu Bui Angela Caba Alexander M Capron Sylvia Caras Amnon Carmi Claudina Cayetano CHEN Yan Fang iv National Progressive Primary Health Care Network, Kensington, South Africa...

Ngày tải lên: 15/03/2014, 01:20

199 471 0
HUMAN RIGHTS AND THE MORAL RESPONSIBILITIES OF CORPORATE AND PUBLIC SECTOR ORGANISATIONS pptx

HUMAN RIGHTS AND THE MORAL RESPONSIBILITIES OF CORPORATE AND PUBLIC SECTOR ORGANISATIONS pptx

... Correctional Organisations DAVID BILES 189 Human Rights, the Moral Vacuum of Modern Organisations, and Administrative Evil GUY ADAMS AND DANNY BALFOUR 205 Humanity, Military Humanism and the New Moral ... we have a right to ‘the highest attainable standard of physical and mental health’.8 But that cannot be so The highest attainable standard of physical and mental health is not even a reasonable ... dignity and human rights, involves far more that conforming to human rights laws, such as anti-discrimination law, and health and safety regulations, and suggests that there is a powerful moral imperative...

Ngày tải lên: 30/03/2014, 02:20

260 499 0
The Police National DNA Database: Balancing Crime Detection, Human Rights and Privacy pdf

The Police National DNA Database: Balancing Crime Detection, Human Rights and Privacy pdf

... the USA, various state laws already allow this to happen For example, a Massachusetts law allows disclosure of DNA records for 'advancing other humanitarian purposes' and Alabama allows access ... information and personal data are stored indefinitely on a DNA database, like the police forensic database known as the National DNA Database (NDNAD) There are fears that this information may be ... DNA analysis has been completed, for example Belgium, Germany, the Netherlands and Norway Other countries, including Austria, England and Wales, Denmark, Finland, Hungary, Slovenia and Switzerland,...

Ngày tải lên: 30/03/2014, 22:20

58 801 0
báo cáo khoa học: "Within but without: human rights and access to HIV prevention and treatment for internal migrants" pot

báo cáo khoa học: "Within but without: human rights and access to HIV prevention and treatment for internal migrants" pot

... Declaration of Commitment on HIV/AIDS to "promote and protect all human rights and fundamental freedoms, including the right to the highest attainable standard of physical and mental health" and ... housing and medical care and necessary social services." [6] The International Covenant on Economic, Social and Cultural Rights also guarantees the right of everyone to the highest attainable standard ... migrants also face particular http://www.globalizationandhealth.com/content/5/1/17 challenges in accessing health care [59,61] Health care is administered on a state-by-state basis in India, and...

Ngày tải lên: 11/08/2014, 14:21

10 235 0
báo cáo khoa học: " Health, human rights, and the conduct of clinical research within oppressed populations" doc

báo cáo khoa học: " Health, human rights, and the conduct of clinical research within oppressed populations" doc

... that collaborates with Thai authorities and addresses drug user issues creates dilemmas that straddle ethics and international human rights law Could participation in a state-authorized clinical ... Mwamburi DM, Bennish ML, Kupelnick B, Ioannidis JP: Clinical trials in sub-Saharan Africa and established standards of care: a systematic review of HIV, tuberculosis, and malaria trial JAMA 2004, ... of examining research from simply an ethical or simply a human rights legal framework As previously stated, there are many international instruments that confer and safeguard the rights of participants...

Ngày tải lên: 11/08/2014, 18:20

10 300 0
Human rights and private life of one person

Human rights and private life of one person

... respect rights: for private life a human rights system can be said to consist of: a list of internationally guaranteed human rights; permanent institutions; International compliance approaches ... or human enforcement rights procedures implementation: - prescribing (defining, formulating) human rights The drafting of human rights standards that are universally acceptable is necessarily an ... their standards to the states parties, the states parties are themselves expected to enact the legislation and other measures that are necessary for implementation But UN again typically plays a supervisory...

Ngày tải lên: 08/05/2016, 22:02

6 333 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

... Purposes and typical legal characteristics of the International 10 Declaration on Human Rights 3.2.1 Purposes 10 3.2.2 Typical legal characteristics 10 3.3 A study of the discourse structure and some ... Structure 5.2 Similarities 34 * Typical structure of an International Declaration on Human Rights 37 * Typical structure of an International Convention on Human Rights 38 * Sources of data 39 * References ... the Declaration and its realization 18 3.3.3.2 Remarks 19 CHAPTER IV THE DISCOURSE STRUCTURE AND SOME MAJOR LINGUISTIC FEATURES OF THE INTERNATIONAL CONVENTION ON HUMAN RIGHTS IN COMPARISON WITH...

Ngày tải lên: 07/11/2012, 14:17

6 634 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  3

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3

... language learning, and is therefore of great importance to language teachers Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while these remain ... Universal Declaration of Human Rights; International Covenants on Civil and Political Rights; International Covenants on Economic, Social and Cultural Rights; United Nation's Declaration of the Rights ... shall be prohibited in all their forms (Article of Universal Declaration of Human Rights) b Use of vocabulary b1 Archaic words and phrases Few archaic words and phrases are found in Declarations...

Ngày tải lên: 07/11/2012, 14:17

41 839 3
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  4

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4

... equality to a fair and public hearing by an independent and impartial tribunal, in the determination of his rights and obligations and of any criminal charge against him Article 11 Everyone charged ... Education shall be free, at least in the elementary and fundamental stages Elementary education shall be compulsory Technical and professional education shall be made generally available and ... Civil and Political Rights (in particular in articles 23 and 24), in the International Covenant on Economic, Social and Cultural Rights (in particular in article 10) and in the statutes and relevant...

Ngày tải lên: 07/11/2012, 14:17

28 612 0
Báo cáo y học: "Conflict and health: a paradigm shift in global health and human rights" ppt

Báo cáo y học: "Conflict and health: a paradigm shift in global health and human rights" ppt

... Editorial Board, Conflict and Health is open-access and freely available to readers around the world In the past, human rights workers, lawyers, health professionals and epidemiologists have chosen ... Conflict and Health References Conflict and Health will explore the relationships between health, human rights, humanitarianism and conflict The journal seeks to explore both the practice and the discipline ... and evaluate it in an evidence based epidemiological approach This journal is part of a growing effort to develop accessible evidence for humanitarian responses http://www.conflictandhealth.com/content/1/1/1...

Ngày tải lên: 13/08/2014, 13:21

2 231 0
Báo cáo y học: "Public health, conflict and human rights: toward a collaborative research agenda" potx

Báo cáo y học: "Public health, conflict and human rights: toward a collaborative research agenda" potx

... Pham P, Weinstein H, Longman T: Trauma and PTSD Symptoms in Rwanda: Implications for Attitudes toward Justice and Reconciliation JAMA 2004, 292:602-12 Cardozo BL, Vergara A, Agani F, Gotway CA: ... way of assessing the extent and impact of violations across populations Research collaboration between public health specialists, conflict analysts and human rights monitors faces practical and ... differentiating between the impacts of air and ground attacks NATO air raids appeared to scatter Taliban forces, leading to fewer civilian casualties; NATO ground attacks against Taliban fighters who held...

Ngày tải lên: 13/08/2014, 13:21

12 401 0
Báo cáo y học: "Community-based assessment of human rights in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone Nargis" pot

Báo cáo y học: "Community-based assessment of human rights in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone Nargis" pot

... importance of human rights considerations in the context of natural disasters and the humanitarian response: Human rights are the legal underpinning of all humanitarian work pertaining to natural ... and design, acquisition of data, and interpretation of data, was involved in drafting the manuscript, and revising it critically for important intellectual content All authors have read and approved ... this article as: Suwanvanichkij et al.: Community-based assessment of human rights in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone Nargis Conflict and Health...

Ngày tải lên: 13/08/2014, 14:20

14 338 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... resonance Anal Biochem 305, 19 Wuerges J, Garau G, Geremia S, Fedosov SN, Petersen TE & Randaccio L (2006) Structural basis for mammalian vitamin B12 transport by transcobalamin Proc Natl Acad Sci USA ... recombinant human proteins IF and TC puried from plants [17] and yeast [18], respectively Both proteins were originally obtained as Cbl-saturated holo-forms, and preparation of the unsaturated apo-forms ... ligand had a cooperative character It leads to higher uorescent response and better xation of CBC Final stabilization of IF30CBCIF20 can occur after series of transitions at the domaindomain...

Ngày tải lên: 19/02/2014, 05:20

12 603 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, a large amount ... 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ (forward) and 5¢-GCTCGAATTCGGATCAG CAACCTCCAAAGGTAGACAGCA-3¢ (reverse) BL21 cells were transformed with the pETM11 construct and grown until a D of 0.8...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

... (5¢-GAT AAAACCACACCTGTAGTAGCTG-3¢) and MCAD 116 5A G (5¢-CCTGTAGAAAGACTAATGAGGGATG CC-3¢) (mutagenic substitutions are shown in bold), and the antisense primer (5¢-GTAACGCCAGGGTTTTCCCA GTCAC-3¢) ... impact greatly on the catalytic activity, as the kcat and the ETF interaction are relatively unaffected This mutation seems to affect mainly the initial folding and stability of the tetramer, and ... disease-causing mutation and comparison with the normal enzyme Eur J Biochem 246, 548–556 15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Purification and characterization of short-chain, mediumchain,...

Ngày tải lên: 20/02/2014, 02:21

9 533 0
w