0

a high throughput assay for dna deaminases

Development and application of a high throughput assay for discovery of starch hydrolase inhibitors

Development and application of a high throughput assay for discovery of starch hydrolase inhibitors

Cao đẳng - Đại học

... αglucosidase and α-amylase can significantly reduce the post-prandial increase in blood glucose after a meal, with starch as the major calorie intake The apparent advantage of the starch hydrolase ... complementary to acarbose 2.3.1 Acarbose Acarbose is a pseudo-tetrasaccharide, because of its structural similarity to typical tetrasaccharides It is bio-synthesized by Actinoplanes, a type of bacteria ... process of starch involves saliva α-amylase, pancreatic αamylase, and the small intestinal brush border α-glucosidase, that is, maltaseamyloglucosidase and sucrase-isomaltase [19, 67] Determination...
  • 225
  • 290
  • 0
báo cáo khoa học:

báo cáo khoa học: " A high sensitivity assay for the inflammatory marker C-Reactive protein employing acoustic biosensing" pptx

Báo cáo khoa học

... zero standard For direct capture this was found to be 13 ng/mL, for homogenous sandwich Assay 20 ng/mL and for the direct Sandwich Assay ng/mL An inter -assay, intra -assay precision profile analysis ... to a sample would take one hour turnaround To deliver a more rapid semi-quantitative assay from a blood sample, a simple, rapid ratio metric assay was thus performed A normalisation standard ... antibodies that are a potential interference in immunoassays [27-30] This initial CRP assay carried out using RAP assay was compared with a commercial, validated high sensitivity ELISA by analysing spiked...
  • 8
  • 919
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Neuraminidase activity provides a practical read-out for a high throughput influenza antiviral screening assay" pptx

Hóa học - Dầu khí

... Ribav irin concentration microM Figure the AVINA amantadine against influenza A and B viruses in Titration of assay Titration of amantadine against influenza A and B viruses in the AVINA assay ... development of the AVINA assay, a high throughput assay that measures NA activity as a read-out for virus replication The advantages of this assay are its ease of execution, reproducibility, and sensitivity ... be administered therapeutically, making it a poor antiviral candidate The AVINA assay can be used in a high throughput format Final assay conditions were used in a blind screen of an ion channel...
  • 8
  • 297
  • 0
DNA chip platform a high throughput genotyping technology for genetic diagnosis and pharmacogenetic profiling

DNA chip platform a high throughput genotyping technology for genetic diagnosis and pharmacogenetic profiling

Cao đẳng - Đại học

... severe anaemia, in between that of thalassaemia minor and major, afflicts the patient This is termed thalassaemia intermedia Southeast Asia lies in the malaria belt where for thousands of years, malaria ... that causes β-thalassaemia syndromes This was one of the research areas in our laboratory for many years and a large number of samples with known mutations of the β-globin chain are available Another ... liquid-phase assay formats, a feasible solution is to design the minisequencing assay on the solid phase, for example, on the DNA chip platform Solid-phase assay formats In solid-phase assay formats, oligonucleotide...
  • 204
  • 403
  • 0
Báo cáo y học:

Báo cáo y học: "Comparison of metal-dependent catalysis by HIV-1 and ASV integrase proteins using a new and rapid, moderate throughput assay for joining activity in solution" ppt

Báo cáo khoa học

... rescence assay is approximately 10–30 times more sensitive than the standard gel assay for measuring this activity In addition, the assay is much faster than gel analysis and numerous samples can be ... incubation Figure activity Moderate -throughput solution assay for integrase joining Moderate -throughput solution assay for integrase joining activity Panel A Principles of a solution assay to measure ... Proc Natl Acad Sci USA 2002, 99:6661-6666 Asante-Appiah E, Skalka AM: A metal-induced conformational change and activation of HIV-1 integrase J Biol Chem 1997, 272:16196-16205 Katz RA, DiCandeloro...
  • 10
  • 414
  • 0
báo cáo khoa học:

báo cáo khoa học: "A signal amplification assay for HSV type 1 viral DNA detection using nanoparticles and direct acoustic profiling" ppsx

Báo cáo khoa học

... The Z-factor provides an easy and useful measure for assay quality and has been a widely accepted standard Z-factor reflects both the assay signal dynamic range and the data variation associated ... limit than a heterogeneous, two-step flow-based assay Completely homogeneous assays are advantageous in that they allow single step, rapid tests that require minimal amounts of sample and are easier ... the assay performance may be increased by using more massive, larger diameter amplification particles such as gold nanoparticles Homogeneous and semi-homogeneous assay with nanoparticle enhancement...
  • 12
  • 394
  • 0
báo cáo khoa học:

báo cáo khoa học: " A high-throughput screening system for barley/powdery mildew interactions based on automated analysis of light micrographs" docx

Báo cáo khoa học

... operates AxioVision via its optionally available Visual Basic for Applications (VBA) interface This script program also provides a graphical user interface where the experimenter parametrizes and ... considered 0.5 automated 0.4 0.3 0.2 0.1 0 0.1 0.2 0.3 manual 0.4 0.5 Figure Correlation between manual and automated analysis Correlation between manual and automated analysis In this evaluation, 45 ... [25] We randomly partitioned the data set and used one half for training the classifier and the other half for testing To obtain a stable informational value, this partitioning, training, and testing...
  • 9
  • 328
  • 0
ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

Vật lý

... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Results for an aperture array defined by a = 750 nm (a) Reflection from aperture array in comparison to a bare silicon ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Absorption enhancement in silicon compared with that without the aperture array in near-IR is near zero if no antenna array ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler R A Pala, J White, E Barnard, J Liu, and M L Brongersma, “Design of plasmonic thin-film solar cells with broadband absorption...
  • 7
  • 297
  • 0
ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

ridge aperture antenna array as a high efficiency coupler for photovoltaic applications

Vật lý

... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Results for an aperture array defined by a = 750 nm (a) Reflection from aperture array in comparison to a bare silicon ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Absorption enhancement in silicon compared with that without the aperture array in near-IR is near zero if no antenna array ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler R A Pala, J White, E Barnard, J Liu, and M L Brongersma, “Design of plasmonic thin-film solar cells with broadband absorption...
  • 7
  • 302
  • 0
Báo cáo y học:

Báo cáo y học: " Identification of a high incidence region for retroviral vector integration near exon 1 of the LMO2 locus" pot

Báo cáo khoa học

... Kafri (University of North Carolina, Chapel Hill, NC, USA) for providing pcDNA VSV-G, Dr H Sakai (Shinshu University, Nagano, Japan) for help with statistical analyses, and Dr T 10 Takeshita ... thank the Instrumental Analysis Research Center for Human and Environmental Science at Shinshu University for technical assistance with DNA sequencing and flow cytometric analyses This work was ... T, Asao H, Ohtani K, Ishii N, Kumaki S, Tanaka N, Munakata H, Nakamura M, Sugamura K: Cloning of the gamma chain of the human IL-2 receptor Science 1992, 257:379-382 Noguchi M, Yi H, Rosenblatt...
  • 9
  • 302
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A new plasmid vector for DNA delivery using lactococci" pptx

Báo cáo khoa học

... ATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAGCTTAAGCTTGGTACCGA BamHI EcoRI PstI EcoRV NotI XhoI GCTCGGATCCGGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTC XbaI ApaI GAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGT ... KpnI AflII NheI ApaI XbaI BsiEI NotI EcoRV PstI EcoRI ClaI polyA MCS Rep C pCMV pValac BglII 3742 bp Rep A Cm T7 promoter/priming site B NheI AflII KpnI ATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAGCTTAAGCTTGGTACCGA ... GAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGT TTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGA polyA Figure Structure of pValac plasmid Structure of pValac plasmid A: Boxes indicate: Multiple...
  • 7
  • 313
  • 0
CHARACTERIZATION OF INHIBITORS OF ALDEHYDE DEHYDROGENASE 2 IDENTIFIED THROUGH A HIGH-THROUGHPUT DOCKING APPROACH

CHARACTERIZATION OF INHIBITORS OF ALDEHYDE DEHYDROGENASE 2 IDENTIFIED THROUGH A HIGH-THROUGHPUT DOCKING APPROACH

Y khoa - Dược

... Retinal Retinal & acetaldehyde Acetaldehyde 10-Formyltetrahydrofolate 10-Formyltetrahydrofolate y-Aminobutyraldehyde Succinate semialdehyde Retinal Malonate semialdehyde Aromatic & Aliphatic Aldehydes ... esterase assay utilized 0.97 mM para-nitrophenylacetate as a standard substrate concentration and enzyme concentration of 0.06 uM for ALDH2 and 2% (v/v) DMSO in all assay conditions The activity ... substrate and available X-ray crystal structure deposition code from the Research Collaboratory for Structural Bioinformatics (RCSB) database (114, Adapted from Strickland et al., 2011) Gene Name ALDH 4A1 ...
  • 58
  • 164
  • 0
High throughput methodologies for enzyme inhibitor profiling

High throughput methodologies for enzyme inhibitor profiling

Cao đẳng - Đại học

... Fodor et al.10 and Brown and colleagues,11,12 and has led to the DNA microarray revolution DNA microarrays are pervasively used today in a wide range of applications, spanning both research and industry, ... KDKD Caspase-3 521 Caspase-3 Caspase-7 440 Caspase-7 200 0 1000 2000 3000 500 R2 R2 0.97 0.97 4000 Caspase-3 Caspase-7 KDKD Caspase-3 565 Caspase-3 Caspase-7 600 Caspase-7 Caspase-3 Caspase-7 ... Fluorescence Polarization Assay 118 6.5.3 Inhibition Assay against PTPs 118 6.5.4 Ca2+-actived Protease Assay 120 6.5.5 Screening for Inhibition Activity against Caspases 120 6.5.6 IC50 Measurements...
  • 226
  • 209
  • 0
High throughput methodologies for systematic enzyme profiling

High throughput methodologies for systematic enzyme profiling

Cao đẳng - Đại học

... technology platform With microarrays, this is attributed to significant advantages rooted in miniaturization, parallelization and automation Breaking away from microtiter-based (or well-based) assays, ... platforms for rapid screening, lead discovery and molecular characterization The essential advantages of microarray and microplate technology are attributed to the massive throughput attainable, ... sub-nanolitre quantities of reagents, and may become available in the near future.20 Various instruments have also enabled a variety of parameters to be analyzed in high- throughput using microplates...
  • 218
  • 300
  • 0
DESIGNING a HIGH PERFORMANCE CRYPTOSYSTEM FOR VIDEO STREAMING APPLICATION

DESIGNING a HIGH PERFORMANCE CRYPTOSYSTEM FOR VIDEO STREAMING APPLICATION

Kỹ thuật lập trình

... International Conference on Advanced Computer Science Applications and Technologies, IEEE [3] Mohamed Khalil Hani, Hau Yuan Wen, Arul Paniandi, “Design and Implementation of a Private and Public ... propose to use carry save adders (CSA) to calculate the intermediate values and ripple carry adder to calculate the final result The hierarchical CSA tree is shown in the Figure In this architecture, ... encrypted by the RSA algorithm, and there is no key establishment separately before data transferring We can change the secret key at anytime without key re-establishment as in traditional cryptosystem...
  • 8
  • 229
  • 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Báo cáo khoa học

... Biotin-TCGACTAGAAGCTTCTAGAAGCTTCTAG AGCTGATCTTCGAAGATCTTCGAAGAT Biotin-TCGACTTCAAGCTTGTACAAGCTTGTAG AGCTGAAGTTCGAACATGTTCGAACATC Biotin-AACGACGGTCGCTCCGCCTGGCT nM Unlabeled HSE DNA- binding activity ... confirm that the assay specifically measures HSF1 DNA- binding activity Analytical range and precision The analytical range of the assay was evaluated using known concentrations of recombinant human HSF1 ... temperature Assay procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the plate wells, and addition...
  • 9
  • 457
  • 0
Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

Báo cáo khoa học

... 101–103 2094 A V Antonov et al 33 Okuda S, Yamada T, Hamajima M, Itoh M, Katayama T, Bork P, Goto S & Kanehisa M (2008) KEGG atlas mapping for global analysis of metabolic pathways Nucleic Acids Res ... reactions that share the same compounds In general, a reaction consists of multiple reactant pairs, and the one that appears in a KEGG metabolic pathway is called a main pair To build a global ... a great demand for bioinformatics to provide a statistically valid interpretation of compound lists produced experimentally Currently, several bioinformatics approaches are available for metabolomics...
  • 11
  • 401
  • 0
Báo cáo y học:

Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

Báo cáo khoa học

... endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, ... default values used in this analysis are summarized in Table S1 in Additional file The software for miRTRAP and other resources are available on our website [49] Additional material Additional ... Kawai J, Suzuki H, Carninci P, Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mattick J, Hume DA, Lipovich L, Batalov S, Engstrom PG, Mizuno Y, Faghihi MA, Sandelin A, Chalk AM,...
  • 12
  • 552
  • 0
Báo cáo y học:

Báo cáo y học: "A novel informatics concept for high-throughput shotgun lipidomics based on the molecular fragmentation query language" ppt

Báo cáo khoa học

... MasterScan: a database of shotgun mass spectra The MasterScan is a flat file database that stores all mass spectra acquired from all analyzed samples, including technical and biological replicates, ... available for testing local installations of the software LipidXplorer benchmarking: the dataset E coli total lipid extract was purchased from Avanti Polar Lipids (Alabaster, AL, USA) and analyzed ... demonstrated that LipidXplorer takes full advantage of the high mass resolution and mass accuracy of a hybrid tandem mass spectrometer It has also become apparent that averaging and alignment of related...
  • 25
  • 514
  • 0
báo cáo khoa học:

báo cáo khoa học: " HAPIscreen, a method for high-throughput aptamer identification" pptx

Báo cáo khoa học

... the automated workstation For each SELEX, μM of the RNA library was heated at 80°C for min, cooled at 4°C for min, placed at room temperature for and mixed DNA primers and the biotinylated DNA anchor ... Mairal T, Cengiz Ozalp V, Lozano Sanchez P, Mir M, Katakis I, O’Sullivan CK: Aptamers: molecular tools for analytical applications Anal Bioanal Chem 2007, 390:989-1007 Dausse et al Journal of Nanobiotechnology ... molecules are also of high potential value in medicine [13] as for instance an anti-VEGF aptamer has been recently approved by the Food and Drug Administration for the treatment of age-related macular...
  • 10
  • 348
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008