... Sanchez-Sinencio Laszlo Kish Charles S Lessard Costas Georghiades May 2006 Major Subject: Electrical Engineering iii ABSTRACT A Low Power, HighDynamic Range, Broadband Variable Gain Amplifier for an Ultra Wideband ... full scale of the ADC Thus, the suitable VGA topology for this design has to provide at least 1Vpp linear range with large variable gain range (42dB) The linear range of the differential pair with ... not suitable for this design, because it cannot simultaneously satisfy the required specifications of large bandwidth, large variable gain range, and large linear range (1Vpp) 12 II.1.2 Analog...
... land uses, markets for carbon As a result, compliance markets attract much more capital Although compliance markets have the potential to generate large demand for ... 2009 was largely seen as a political about the appropriateness of this forum for dealing with climate change negotiations As a result, many observers and participants ... cast doubt on future income from regional or global compliance carbon markets Demand for forest carbon through smaller markets, such as the California cap-and- trade...
... some classier trained for the target task These auxiliary classiers can be adequately learned since we have very large amounts of training data for them, which we automatically generate from a very ... English and German data Most of the top systems boost performance by external hand-crafted resources such as: large gazetteers4 ; a large amount (2 million words) of labeled data manually annotated ... BLN, Avg, Year-on-year, UNCH New, France, European, San, North, Japan, Asian, India Peter, Sir, Charles, Jose, Paul, Lee, Alan, Dan, John, James June, May, July, Jan, March, August, September, April...
... Advanced HighDynamicRange Imaging This page intentionally left blank Advanced HighDynamicRange Imaging Theory and Practice Francesco Banterle Alessandro Artusi Kurt Debattista Alan Chalmers ... Warwick and Bristol: Patrick, Kurt, Alessandro, Alan, Karol, Kadi, Luis Paulo, Sumanta, Piotr, Roger, Matt, Anna, Cathy, Yusef, Usama, Dave, Gav, Veronica, Timo, Alexa, Marina, Diego, Tom, Jassim, ... the past few years at Bristol and Warwick: Matt Aranha, Kadi Bouatouch, Kirsten Cater, Joe Cordina, Gabriela Czanner, Silvester Czanner, Sara de Freitas, Gavin Ellis, Jassim Happa, Carlo Harvey,...
... since each participant need provide capacity only for the average load, not for that participant’s peak load Dabek et al describe a realization of this idea that uses Chord to map data blocks ... is a variant of the Plaxton algorithm Like Chord, it guarantees that queries make no more than a logarithmic number of hops and that keys are well-balanced The Plaxton protocol’s main advantage ... that map to a particular node, thus creating a badly distributed set of keys As with standard hashing, however, we expect that a non-adversarial set of keys can be analyzed as if it were random...
... GPS Antenna Considerations forAutomotiveApplications GPS01 LNA PCB Design The LNAs used in M /A- COM’s active antennas are high performance GaAs MMICs in low cost SOIC 8-lead surface mount plastic ... figure, high gain, highdynamic range, and low power consumption are required The LNA is fabricated using a mature 0.5-micron gate length GaAs process which features full passivation for increased ... M /A- COM LNAs also provide excellent RF performance over arange of DC biasing They are capable of specified operation at a bias voltage as low as +3 VDC Even at this low voltage, current draw...
... cameras, digital cinematography cameras should be able to deliver variable frame rates As usual, there is a tradeoff Varying frame rates will have an impact on complexity, compatibility, and image ... 2001 DALSA Corp 605 McMurray Rd Waterloo Ontario, Canada N2V 2E9 dc@dalsa.com www.dalsa.com/dc DALSA has designed leading-edge CCD and CMOS imagers for 25 years Given the demands and limitations ... 03-70-00218-01 ImageSensor Architectures for Digital Cinematography frame rates, and while these taps must be matched by image processing circuits in the camera, DALSA deemed this an acceptable tradeoff for...
... 60%) and transferred on gamma counter tubes The radioactivity was counted on a gamma counter (Riastar, Packard Instrument, USA), and each point was the mean of triplicates Binding data were analyzed ... pea seeds and resist the toxic activity of pea albumin PA1b: five susceptible strains ÔS oryzae WAA42, Benin, and Bouriz, S zeamais LS, and S granarius BrayardÕ and four fully resistant S oryzae ... PA1b, calculated by the ratio of the radioactivity measured by gamma counting and the amount of peptide evaluated by absorbance at 210 nm during HPLC analysis, was about 942 CiÆmmol)1 This value...
... regression analysis: slow phase (0.92 for P < 1200 bar, 0.75 for P > 1200 bar); fast phase (0.72 for P < 1000 bar, 0.93 for P > 1000 bar) Table the water influx rate is clearly smaller for substrate ... activation entropy in substrate-free P450cam may indicate that the CO molecule travels along many pathways to the heme iron Along each pathway, however, many contacts (e.g contacts to many water ... complexes Because the activation volumes for both phases in substratefree, respective camphane-bound, P450cam are qualitatively similar (positive for substrate-free and negative for camphane) we exclude...
... 5Â-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense primer, 5Â-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3Â; 2.5I antisense primer, 5Â-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ... CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ATTTTCTTTTCTTTAATCTTGTTTC-3Â; FT1AA sense primer, 5Â-GATTAAAGAAAAGCTTAAAATTGGTCA GAAAATCC-3Â; FT1AA antisense primer, 5Â-GGA TTTTCTGACCAATTTTAAGCTTTTCTTTAATC-3Â; ... actininstFRET images 3082 FEBS Journal 275 (2008) 30723087 Journal compilation ê 2008 FEBS No claim to original US government works F Meng et al AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA...
... process, and to realize parallel nanopatterning and move toward scalable parallel lithography We demonstrate parallel lithography results using a 5Â5 array of bowtie aperture antennas as focusing elements, ... alignment As mentioned before, for near-field optical nanolithography, the alignment between the mask and the substrate is critical For parallel lithography using multiple antennas, it After aligning ... interferometric-spatial-phase-imaging (ISPI) to control a gap distance of the order of nanometers for parallel optical near-field nanolithography In optical nearfield nanolithography, the distance between...
... Srigungsitthisunti, and Xu: Ridge aperture antenna array as ahigh efficiency coupler Fig Results for an aperture array defined by a = 750 nm (a) Reflection from aperture array in comparison to a bare silicon ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as ahigh efficiency coupler Fig Absorption enhancement in silicon compared with that without the aperture array in near-IR is near zero if no antenna array ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as ahigh efficiency coupler R A Pala, J White, E Barnard, J Liu, and M L Brongersma, “Design of plasmonic thin-film solar cells with broadband absorption...