a guide for the dental team

... of a patient's asthma control with a quick glance Patients assume active role in their health care Implementation: The Asthma Task Force developed an Asthma Test, Asthma Management Plan, and Asthma ... include attempts to maintain physical and emotional balance and harmony, religious practices, and ethnobotanical and other therapies These therapies include prayer, Vick’s VapoRub, siete jarabes, aloe ... within the health centers The Asthma Task Force developed medical record documents to facilitate superior asthma care (including an Asthma Test, Asthma Management Plan, and Asthma Action Plan),...

Ngày tải lên: 14/02/2014, 13:20

... residential and commercial customers ACCA was formed in 1969 through the merger of the Air Conditioning and Refrigeration Contractors of America (established in 1946) and the National Warm Air Heating ... per year After the one-year payback, she puts that extra money toward profits year after year H O T W A T E R ~ APPENDIX A: Energy-Related Agencies and Organizations Air Conditioning Contractors ... Y P A Y S If you use a lot of hot water (more than 100 gallons a day) and don’t have gas service available, consider replacing your regular electric water heater with a heat pump water heater...

Ngày tải lên: 18/02/2014, 00:20

... Central, Eastern and South Eastern European countries, as well as Mongolia, the Russian Federation and the Middle East and North Africa The OECD Istanbul Centre has a stakeholder-oriented management ... of financial resources and lack of capacity to handle complex business management issues as well as a complicated and bureaucratic environment present major obstacles As a result, there is an urgent ... markets and compete on fair terms Taxation and financial matters Tax systems should be adapted to reward success, encourage start-ups, favour small business expansion and job creation, and facilitate...

Ngày tải lên: 18/02/2014, 00:20

... our gratitude to Veronika Boesch, Marilyn Dabady, Michael Frisch, Marina Tyazhelkova, and Ann-Caroline van der Ham We are especially thankful to our editorial team, Matt Davis and Susan Rachmeler, ... work has changed drastically The same forces that are changing our lives in organizations are driving the greater use of coaching (see Table 1.1) The demands placed on organizational leadership ... a history of increased acceptance There is no clear starting point for the use of coaching... effort • Valid data Change and learning require good data, and the coach can help in that...

Ngày tải lên: 08/03/2014, 16:20

... PA training is a fast track to medical practice It is also a fast track to the development of professionalism and ethically appropriate medical behavior There are advantages and disadvantages ... presented a list of standards for professionalism that the authors think should be universally accepted.10 (Box 1-3) In May 2000, the American Academy of Physician Assistants (AAPA) adopted ... clinical practice The most obvious advantage to the fast-track PA training is also its short duration The average PA program is 26 months The didactic year is usually only 12 months The...

Ngày tải lên: 16/03/2014, 04:20

... hold the information I need? How often is the database updated? Can I limit my search to a particular format? Can I change the number of results I see on a results page? What advanced features are ... sites that require a paid subscription or offer information for a fee, in part as a reminder that (as the serious searcher is already aware) not all of the good stuff is available for free on the ... text, graphics, and sounds, and creating what was at that time for most of us unimaginable potential for access to information Within less than a half-decade, the Web had overtaken e-mail and FTP...

Ngày tải lên: 27/06/2014, 02:20

... The boss has authority to take or recommend disciplinary actions, rewards, and other organizational actions... career advising and advancement Therapy is provided as a mental health service ... mentioned earlier A boss cannot do what an independent coach does The boss has much greater accountability for achieving results and for clarifying realistic expectations and standards The ... another As we grew into adulthood, trial and error became perhaps the most common learning method We also learn by reading about what others have done, watching what others do, or occasionally...

Ngày tải lên: 28/06/2014, 10:20

... me sane, and forgiving the disappearances, hibernation, and mood swings that accompanied the. .. director of A List Apart (www.alistapart.com), a weekly magazine For People Who Make Websites”; ... regarded as affecting the validity of any trade- mark or service mark. Warning and Disclaimer Every effort has been made to make this book as complete and as ac- curate as possible, but no warranty ... important than the specific examples 2 Sites should not arbitrarily change page locations, but unfortunately, many do If a particular web page seems to have disappeared, try factoring the...

Ngày tải lên: 03/07/2014, 08:20

... to a new location, and the creator neglects to leave a forwarding address. There are as many scenarios as there are web pages that have disappeared. This is a problem for web users who book- mark ... not comfortable with the idea that a career in web design necessitates continual learning, put this book down now and back slowly away.) On the other hand, you might like the idea that the Web ... parental warnings on CDs and cassettes, and an impassioned plea for school prayer... After designers and their clients grasped the Web’s commercial potential, they began seeking ways to make...

Ngày tải lên: 03/07/2014, 08:20

... such as Alta Vista’s Babelfish (babelfish.altavista.com) translate text on the Web into a variety of languages These translations may be awkward and... coverage in the traditional news media ... Thus, JavaScript was bandwidth-friendly. JavaScript eventually became a standard, but not before putting Microsoft at a competitive disadvantage for several years. The latest, “standard” ver- ... than Netscape’s. In 1995, Netscape came up with a programming language initially called LiveScript and eventually renamed JavaScript. Besides being easy to learn (at least, as far as programming...

Ngày tải lên: 03/07/2014, 08:20

... will typically create a comp in Adobe Photoshop, cut it apart in Adobe ImageReady, and use Macromedia Dreamweaver or Adobe GoLive to put it together again as a working web page. The page may look ... 11:15 AM Page 50 [...]... will talk about ways of doing that Gamma Gamma Hey! Gamma is a measurement of light, and different platforms come with different standard gamma settings The Macintosh ... hardware gamma correction Typically, their System Gamma is estimated at 2.4— darker than Macintosh In practice, PC gamma can be all over the place, but... should calibrate their monitors, set their...

Ngày tải lên: 03/07/2014, 08:20

... (visual Muzak) is because their familiarity makes them appear intuitive, and they therefore survive the pre-launch “user testing” phase For several years, nearly all sites offered left-hand navigation ... HTML that way—and later, it was easier to control that way Because it was easier to program, a. .. worse than any other menu placement But for several years, nearly all sites stuck their ... which reads the way people talk, also can go a long way toward bring- ing warmth and humanity to the onscreen experience. These approaches enable anyone to create a site that feels like a living...

Ngày tải lên: 03/07/2014, 08:20

... an office are open to the public, and which are private. Folks can find their way to a bathroom or a public telephone without asking for help. The goal of a navigational interface, like the goal ... rather than arrows to indicate “previous page” and “next page” on the site. To you, as a visual person, it is readily appar- ent that the rope at the edge of the lasso “points” forward or backward. ... forcing the reader to click to a new screen after every paragraph or two, and you practically guarantee... navigational scheme, and you will win their admiration and more, importantly, that...

Ngày tải lên: 03/07/2014, 08:20

... bottom of the site. It can live in a navigation bar on the left or right side of the page. It also can float in a JavaScript remote popup window (as long as alternatives are provided). What matters ... people can carry on an argument even when they are miles apart 1858 The first Atlantic cable is laid across the ocean floor, facilitating telecommunications between Europe and the United States ... interfaces: interfaces that don’t just look like the brand, they behave like it. Interfaces that look and act like the brand and that guide the right audi- ence to the most important content or transactions...

Ngày tải lên: 03/07/2014, 08:20

... so the con- sultant argued, and the agency apparently agreed. The story may be apocryphal, we hasten to add, because Grey has more lawyers than our publisher. We mention the whole thing because, ... China. The Document Object Model (DOM) is a web standard that lets these other standards “talk to each other” to perform actions. (For more about this, see Chapter 11.) With the increasing specialization ... print. ECMAScript is a standardized version of JavaScript. See Chapter 11, ? ?The Joy of JavaScript,” for more particulars on this topic. Cascading Style Sheets (CSS) is a standard that enables designers...

Ngày tải lên: 03/07/2014, 08:20

... (cAMP) represents a potential target as it is one of the main intracellular factors regulating cell proliferation and apoptosis [5] Prostacyclin analogues are an established vasodilator therapy ... therapy for PAH that act mainly via IP receptors to stimulate adenylyl cyclase and intracellular cAMP levels [6], but also have anti-proliferative actions on human PASMCs, which may be important for ... demonstrated that PDE4 genes are expressed in human distal PASMCs In addition to attenuating DNA synthesis and cell proliferation, stimulation of the cAMP signalling pathway was accompanied by increased...

Ngày tải lên: 12/08/2014, 16:20

... TGACAGGGACAACGACCCTCTCCCAGGGGCGACAGCAAGCCCCCAAGGACAAAA c-Myb CTAGCAGGGACTAGTCATCAGCCAAAAAGGTCAACTGTCTCACACAAATAAGGAT bZIP910 Distal 21R in PTLV-1/2 CCGAAGGTTCTGACGTCCCAGCCCAGCCTCAAAACCAGGAAATCCATAGAAATGC ... CCGAAGGTTCTGACGTCCCAGCCCAGCCTCAAAACCAGGAAATCCATAGAAATGC Middle 21R ACCTCGCCCTTACCCACTTCCCCTATCATGAAAAACAAAGGCTGTGACGACTACCC Proximal 21R CCTTCCCCAAAAAATTTGCTTAAACCATCAATAAAGACAGCCTAGCCTATATAAGC TATA box poly (A) signal U3 R ATGAGGATGGTTCAGGAGGGGGCTCGCTCTCTTGCCGATCGCCCTGCTCACCTCGA ... 5'GGGGATGGTAAAGGCGAAGTAGGG3', and 1863LF3 5'CGTCCCAGCCCAGCCTCAAAACCA 3'and 1863PR5 5'GGGAATCTGGAAGAAAGCGTCCGT3', respectively The external and internal primer sequences for the pol-env fragment are...

Ngày tải lên: 13/08/2014, 05:21

... protect the child from all forms of sexual exploitation and sexual abuse For these purposes, States Parties shall in particular take all appropriate national, bilateral and multilateral measures ... pornographic performances and materials Article 35 States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale of or traffic in ... financial assistance in case of need; (c) Make higher education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance...

Ngày tải lên: 07/11/2012, 14:17

... CATAGTGGAAAGAGGGATATAAATTATCGCATAAAACAATAAACAAAAAGAAAAATG AGGGAACAAAAGCTGGAG GGGAGTCAGCTGTTCGGTAACAGCATCTTGCATAGGCACATCTAAATCTGTATCCTGTAGGGCGAATTGGG GCAAAGTAAAACAGCACGAAAAAAGTGATTACAAATTTCAAGGGAGATATGATGAGGGAACAAAGGCTGGAG ... GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT CGGATCCCCGGGTTAATTAA CCAAGTGCTTCAATCCTAGAGAAGAAGAAAGGTAAGAAAAAGAAAGGAAAGCAACTTAAT GAATTCGAGCTCGTTTAAAC pFA 6a- HIS3MX6 pFA 6a- HIS3MX6 pFA 6a- 13Myc-HIS3MX6 ... GTAACTTCAGGTAGTAACTGGGCCTTGTATAGCCTTTCTAAACATTCGTCCAACTGTAGGGCGAATTGGG GAAATACTATTGAAGCTCAAAAACATCCATAATAAAAGGAACAATAACAATGGTAAGGGAACAAAAGCTGGAG GCGCCTGGCATTTCTTTATTGTTTCAAGCCATTCGTCGGGGCCTCTAGACTGTAGGGCGAATTGGG GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT...

Ngày tải lên: 07/03/2014, 12:20

... mixture was incubated at 37 °C for 40 and then heated at 95 °C for Thereafter, bacterial alkaline phosphatase (0.6 units) was added, and the mixture was further incubated at 65 °C for 30 The mixture ... The radioactivity at the sites to which Pi and ATP migrated was measured, and the ratio of the released Pi to ATP was calculated The ratio in the case of the reaction performed without the enzyme ... Pi and ATP migrated was measured, and the ratio of the released Pi to ATP was calculated The ratio obtained in the case of the reaction performed without the enzymes was subtracted from that...

Ngày tải lên: 23/03/2014, 04:21